Skip to Content
Merck

EHU089561

MISSION® esiRNA

targeting human ADAM12

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCTCTGGATCCCAGTGAAGAGCTTCGACTCCAAGAATCATCCAGAAGTGCTGAATATTCGACTACAACGGGAAAGCAAAGAACTGATCATAAATCTGGAAAGAAATGAAGGTCTCATTGCCAGCAGTTTCACGGAAACCCACTATCTGCAAGACGGTACTGATGTCTCCCTCGCTCGAAATTACACGGTAATTCTGGGTCACTGTTACTACCATGGACATGTACGGGGATATTCTGATTCAGCAGTCAGTCTCAGCACGTGTTCTGGTCTCAGGGGACTTATTGTGTTTGAAAATGAAAGCTATGTCTTAGAACCAATGAAAAGTGCAACCAACAGATACAAACTCTTCCCAGCGAAGAAGCTGAAAAGCGTCCGGGGATCATGTGGATCACATCACAACACACCAAACCTCGCTGCAAAGAATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ADAM12(8038)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Junwen Wang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 97, 1066-1077 (2017-11-16)
Pituitary adenomas are the second most common primary brain tumor with invasive properties. We have previously identified that ADAM12 (a disintegrin and metalloprotease 12) overexpression is associated with the tumor invasion of pituitary adenomas, however, the underlying mechanism remains unknown.
Lingdan Chen et al.
Experimental biology and medicine (Maywood, N.J.), 242(14), 1432-1443 (2017-06-24)
Individuals with diabetes mellitus suffer from impaired angiogenesis and this contributes to poorer peripheral arterial disease outcomes. In experimental peripheral arterial disease, angiogenesis and perfusion recovery are impaired in mice with diabetes. We recently showed that a disintegrin and metalloproteinase
Yuto Nakamura et al.
American journal of physiology. Heart and circulatory physiology, 318(2), H238-H251 (2019-11-28)
A disintegrin and metalloproteinase (ADAM)12 is considered to promote cardiac dysfunction based on the finding that a small-molecule ADAM12 inhibitor, KB-R7785, ameliorated cardiac function in a transverse aortic constriction (TAC) model by inhibiting the proteolytic activation of heparin-binding-EGF signaling. However