Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACCTCTGGATCCCAGTGAAGAGCTTCGACTCCAAGAATCATCCAGAAGTGCTGAATATTCGACTACAACGGGAAAGCAAAGAACTGATCATAAATCTGGAAAGAAATGAAGGTCTCATTGCCAGCAGTTTCACGGAAACCCACTATCTGCAAGACGGTACTGATGTCTCCCTCGCTCGAAATTACACGGTAATTCTGGGTCACTGTTACTACCATGGACATGTACGGGGATATTCTGATTCAGCAGTCAGTCTCAGCACGTGTTCTGGTCTCAGGGGACTTATTGTGTTTGAAAATGAAAGCTATGTCTTAGAACCAATGAAAAGTGCAACCAACAGATACAAACTCTTCCCAGCGAAGAAGCTGAAAAGCGTCCGGGGATCATGTGGATCACATCACAACACACCAAACCTCGCTGCAAAGAATGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ADAM12(8038)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Junwen Wang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 97, 1066-1077 (2017-11-16)
Pituitary adenomas are the second most common primary brain tumor with invasive properties. We have previously identified that ADAM12 (a disintegrin and metalloprotease 12) overexpression is associated with the tumor invasion of pituitary adenomas, however, the underlying mechanism remains unknown.
Lingdan Chen et al.
Experimental biology and medicine (Maywood, N.J.), 242(14), 1432-1443 (2017-06-24)
Individuals with diabetes mellitus suffer from impaired angiogenesis and this contributes to poorer peripheral arterial disease outcomes. In experimental peripheral arterial disease, angiogenesis and perfusion recovery are impaired in mice with diabetes. We recently showed that a disintegrin and metalloproteinase
Yuto Nakamura et al.
American journal of physiology. Heart and circulatory physiology, 318(2), H238-H251 (2019-11-28)
A disintegrin and metalloproteinase (ADAM)12 is considered to promote cardiac dysfunction based on the finding that a small-molecule ADAM12 inhibitor, KB-R7785, ameliorated cardiac function in a transverse aortic constriction (TAC) model by inhibiting the proteolytic activation of heparin-binding-EGF signaling. However