Skip to Content
Merck

EHU091361

MISSION® esiRNA

targeting human MRE11

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTCTGTAAAAAGATCCCTGAGATTATTCCTTCTTCTAGTTTTATGCGACAGCTTTACTTTAAAATTCAAGTTATACATCTTGGGAGTACAATGGCCCGACATTTCTTCATAGGTAGAAACAAATACTTGACTCAGTGATACTCATGACCATTAGAATAGTCATACCTGGAATGTGTCAAATTATAAGAGACAGACACTTGGTTAGTGGCTGCCTCATATAGCACTTTTGAAGAGGCCTAAGTCAAAACTTGCAATATAACATTCTATTGACTTTCTTAAAAATATTTTTTCTGTACCTAACTTGAGCATAAGGGTTATTTGAGCAAGTAACATTAACTCAGTGGAAGGCATTGTCCTGTGAAATATTCTTAGGCAGATCTGCCCACATCTTTATTGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

MRE11A (meiotic recombination 11 homolog A) is a nuclease which forms complex with Rad50 (DNA repair protein) and Nbs1 (nijmegen breakage syndrome protein 1). This complex works as a sensor of DNA double strand breaks, and is involved in DNA repair processes and DNA damage response. Absence of the complex activity causes developmental and/or degenerative neuronal disorders. In homologous recombination repair, MRE11A is responsible for the 3′-to-5′ exonuclease activity, leading to the generation of protruding 3′ ssDNA at double strand breaks. MRE11A is also an oncoprotein which is associated with colorectal cancer and malignant breast cancer. Hypomorphic mutations in this gene leads to Ataxia-Telangiectasia like disorder.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Interaction of MRE11 and Clinicopathologic Characteristics in Recurrence of Breast Cancer: Individual and Cumulated Receiver Operating Characteristic Analyses.
Yang CH
BioMed Research International, 2017, 2563910-2563910 (2017)
Rad51 recombinase prevents Mre11 nuclease-dependent degradation and excessive PrimPol-mediated elongation of nascent DNA after UV irradiation.
Vallerga MB
Proceedings of the National Academy of Sciences of the USA, 112, E6624-E6624 (2015)
M Petroni et al.
Cell death and differentiation, 23(2), 197-206 (2015-06-13)
The MRE11/RAD50/NBS1 (MRN) complex is a major sensor of DNA double strand breaks, whose role in controlling faithful DNA replication and preventing replication stress is also emerging. Inactivation of the MRN complex invariably leads to developmental and/or degenerative neuronal defects