Skip to Content
Merck

EHU091571

MISSION® esiRNA

targeting human CADM1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGATGGGCAGAATCTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGTGACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTGAAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCAATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATCACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAGATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CADM1(23705)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Richard Hunte et al.
PLoS pathogens, 14(4), e1006968-e1006968 (2018-04-27)
Approximately 12% of all human cancers worldwide are caused by infections with oncogenic viruses. Kaposi's sarcoma herpesvirus/human herpesvirus 8 (KSHV/HHV8) is one of the oncogenic viruses responsible for human cancers, including Kaposi's sarcoma (KS), Primary Effusion Lymphoma (PEL), and the
Hye-Ran Kim et al.
Frontiers in immunology, 11, 591054-591054 (2021-02-19)
A robust T-cell response is an important component of sustained antitumor immunity. In this respect, the avidity of TCR in the antigen-targeting of tumors is crucial for the quality of the T-cell response. This study reports that the transmembrane (TM)
Shu-Jun Wang et al.
Molecular medicine reports, 22(5), 3795-3803 (2020-10-02)
Melanoma is a malignant skin cancer type associated with a high mortality rate, but its treatment is currently not ideal. Both microRNA (miR)‑214 and cell adhesion molecule 1 (CADM1) are differentially expressed in melanoma, but their role in this cancer type