Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGTACAAGGGTATGGTAATGCTTGTAGAATCTTTATTATCTCAACAATCTAAAAAATGATGTTTATTTCCATAGTTTGATAGTGCCACTTAAATGCCAATTAAACAAGAATATAACATTTCAATAGAAATTTTTATTTCATTTTCAATTACTTTGTAAATTCGTGTGTATTTAGTACACTGATTTGTTTTTTTACATTTCTGCTTTGAATGCAGATGCAATTTAATATAATAGATTTTTTAATGAATTAATCTTAACATAGTAATCTTTAGCTTTTTATACAAATATATTTAATTTAGGAGTATATGTGTGTCTATACACACACATACATAAATATACCACATATACACCTGATAGTCAAATAAGGTACAGAAATTTTATCTTGTCAATTATGCCAAATAATCTCTTTAATGTGCACTCAAACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ADK(132)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Iwona Pelikant-Malecka et al.
The international journal of biochemistry & cell biology, 88, 31-43 (2017-03-23)
4-pirydone-3-carboxamide-1β-d-ribonucleoside (4PYR) is an endogenous nucleoside that could be converted to triphosphates, diphosphates, monophosphates and an analogue of NAD - 4PYRAD. Elevated level of these compounds have been reported in chronic renal failure, cancer and active HIV infection. However, little
Alexander J Valvezan et al.
JCI insight, 5(7) (2020-04-10)
Recent studies in distinct preclinical tumor models have established the nucleotide synthesis enzyme inosine-5'-monophosphate dehydrogenase (IMPDH) as a viable target for antitumor therapy. IMPDH inhibitors have been used clinically for decades as safe and effective immunosuppressants. However, the potential to
Adenosine kinase facilitated astrogliosis-induced cortical neuronal death in traumatic brain injury.
Wei Jin et al.
Journal of molecular histology, 47(3), 259-271 (2016-03-18)
Adenosine kinase (ADK) plays a pivotal role in regulating brain function by regulating adenosine level, and ADK inhibition protects against neuronal damage in cerebral ischemia and epilepsy; however, the effects of ADK in traumatic brain injury (TBI) have not been