Skip to Content
Merck

EHU104101

MISSION® esiRNA

targeting human ATXN2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human ATXN2

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGGAACTTGAGGCTTTGGAAAATGACGTATCTAATGGATGGGATCCCAATGATATGTTTCGATATAATGAAGAAAATTATGGTGTAGTGTCTACGTATGATAGCAGTTTATCTTCGTATACAGTGCCCTTAGAAAGAGATAACTCAGAAGAATTTTTAAAACGGGAAGCAAGGGCAAACCAGTTAGCAGAAGAAATTGAGTCAAGTGCCCAGTACAAAGCTCGAGTGGCCCTGGAAAATGATGATAGGAGTGAGGAAGAAAAATACACAGCAGTTCAGAGAAATTCCAGTGAACGTGAGGGGCACAGCATAAACACTAGGGAAAATAAATATATTCCTCCTGGACAAAGAAATAGAGAAGTCATATCCTGGGGAAGTGGGAGACAGAATTCACCGCGTATGGGCCAGCCTGGATCGGGCTCCATGCCATCAAGATCCACTTCTCACACTTCAGATTTCAACCCGAATTCTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nesli Ece Sen et al.
Neurobiology of disease, 96, 115-126 (2016-10-19)
Ataxin-2 (ATXN2) polyglutamine domain expansions of large size result in an autosomal dominantly inherited multi-system-atrophy of the nervous system named spinocerebellar ataxia type 2 (SCA2), while expansions of intermediate size act as polygenic risk factors for motor neuron disease (ALS
Jongbo Lee et al.
PLoS biology, 18(12), e3001002-e3001002 (2020-12-29)
Nucleocytoplasmic transport (NCT) defects have been implicated in neurodegenerative diseases such as C9ORF72-associated amyotrophic lateral sclerosis and frontotemporal dementia (C9-ALS/FTD). Here, we identify a neuroprotective pathway of like-Sm protein 12 (LSM12) and exchange protein directly activated by cyclic AMP 1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service