Skip to Content
Merck

EHU115021

MISSION® esiRNA

targeting human NF1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATGGATCGGCTGTTGTCCTTAATGGTGTGTAACCATGAGAAAGTGGGACTTCAAATACGGACCAATGTTAAGGATCTGGTGGGTCTAGAATTGAGTCCTGCTCTGTATCCAATGCTATTTAACAAATTGAAGAATACCATCAGCAAGTTTTTTGACTCCCAAGGACAGGTTTTATTGACTGATACCAATACTCAATTTGTAGAACAAACCATAGCTATAATGAAGAACTTGCTAGATAATCATACTGAAGGCAGCTCTGAACATCTAGGGCAAGCTAGCATTGAAACAATGATGTTAAATCTGGTCAGGTATGTTCGTGTGCTTGGGAATATGGTCCATGCAATTCAAATAAAAACGAAACTGTGTCAATTAGTTGAAGTAATGATGGCAAGGAGAGATGACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dana Rabara et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(44), 22122-22131 (2019-10-16)
KRAS mutations occur in ∼35% of colorectal cancers and promote tumor growth by constitutively activating the mitogen-activated protein kinase (MAPK) pathway. KRAS mutations at codons 12, 13, or 61 are thought to prevent GAP protein-stimulated GTP hydrolysis and render KRAS-mutated
K Mellert et al.
Scientific reports, 8(1), 6171-6171 (2018-04-20)
In Neurofibromatosis 1 (NF1) germ line loss of function mutations result in reduction of cellular neurofibromin content (NF1+/-, NF1 haploinsufficiency). The Ras-GAP neurofibromin is a very large cytoplasmic protein (2818 AA, 319 kDa) involved in the RAS-MAPK pathway. Aside from regulation
Ritsuko Harigai et al.
Scientific reports, 8(1), 6069-6069 (2018-04-19)
Neurofibromatosis type 1 (NF1) is caused by germline mutations in the NF1 gene and is characterized by café au lait spots and benign tumours known as neurofibromas. NF1 encodes the tumour suppressor protein neurofibromin, which negatively regulates the small GTPase
Lionel Larribère et al.
Translational oncology, 13(12), 100858-100858 (2020-09-07)
Metastases's spreading is the main cause of mortality for advanced stage cancer patients, including melanoma. The formation of metastases is favored by enhanced migratory and invasive capacities of tumor cells. Tumor suppressor gene NF1 is a negative regulator of RAS
Ze-Yi Zheng et al.
Cancer cell, 37(3), 387-402 (2020-03-07)
We report that neurofibromin, a tumor suppressor and Ras-GAP (GTPase-activating protein), is also an estrogen receptor-α (ER) transcriptional co-repressor through leucine/isoleucine-rich motifs that are functionally independent of GAP activity. GAP activity, in turn, does not affect ER binding. Consequently, neurofibromin

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service