Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTGGCCTGCTACTTCTACGAGCAGGCCTTCCGCGAGCACTGGGAGCGCACCTGGCTCCTGCAGACGTGCAAGAGCTATGCCGTGCCCTGCCCGCCCGGCCACTTCCCGCCCATGAGCCCCGACTTCACCGTCTTCATGATCAAGTACCTGATGACCATGATCGTCGGCATCACCACTGGCTTCTGGATCTGGTCGGGCAAGACCCTGCAGTCGTGGCGCCGCTTCTACCACAGACTTAGCCACAGCAGCAAGGGGGAGACTGCGGTATGAGCCCCGGCCCCTCCCCACCTTTCCCACCCCAGCCCTCTTGCAAGAGGAGAGGCACGGTAGGGAAAAGAACTGCTGGGTGGGGGCCTGTTTCTGTAACTTTCTCCCCCTCTACTGAGAAGTGACCTGGAAGTGAGAAGTTCTTTGCAGATTTGGGGCGAGGGGTGATTTGGAAAAGAAGACCTGGGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FZD7(8324)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yan Geng et al.
Oncology reports, 35(4), 2441-2450 (2016-01-20)
MicroRNAs (miRNAs) are novel tools for cancer therapy. Frizzled7 (FZD7) is an important co-receptor in the WNT signaling pathway. The WNT signaling pathway is aberrantly activated in Helicobacter pylori (H. pylori)‑infected gastric cancer cells. However, the role of FZD7 in
Yufeng Wang et al.
Cell death & disease, 9(9), 851-851 (2018-08-30)
Previous evidences reveal that long non-coding RNA (lncRNA) down syndrome critical region 8 (DSCR8) involves in the progression of multiple cancers. However, the exact expression, function, and mechanism of DSCR8 in hepatocellular carcinoma (HCC) remain uncovered. In this study, real-time
M Asad et al.
Cell death & disease, 5, e1346-e1346 (2014-07-18)
Ovarian cancer (OC) can be classified into five biologically distinct molecular subgroups: epithelial-A (Epi-A), Epi-B, mesenchymal (Mes), Stem-A and Stem-B. Among them, Stem-A expresses genes relating to stemness and is correlated with poor clinical prognosis. In this study, we show