Skip to Content
Merck

EHU131171

MISSION® esiRNA

targeting human USP7

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACGTGACTTGCTCCCAGTTATGTGTGACAGAGCAGGATTTATTCAAGATACTAGCCTTATCCTCTATGAGGAAGTTAAACCGAATTTAACAGAGAGAATTCAGGACTATGACGTGTCTCTTGATAAAGCCCTTGATGAACTAATGGATGGTGACATCATAGTATTTCAGAAGGATGACCCTGAAAATGATAACAGTGAATTACCCACCGCAAAGGAGTATTTCCGAGATCTCTACCACCGCGTTGATGTCATTTTCTGTGATAAAACAATCCCTAATGATCCTGGATTTGTGGTTACGTTATCAAATAGAATGAATTATTTTCAGGTTGCAAAGACAGTTGCACAGAGGCTCAACACAGATCCAATGTTGCTGCAGTTTTTCAAGTCTCAAGGTTATAGGGATGGCCCAGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... USP7(7874)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Xiaomeng Dai et al.
Theranostics, 10(20), 9332-9347 (2020-08-18)
Background: Tumor associated macrophages (TAMs) have strong plasticity and if reprogrammed, can clear tumor cells and regulate the adaptive immune system for cancer immunotherapy. Deubiquitinating enzymes (DUBs), which can remove ubiquitin (Ub) from Ub-modified substrates, have been associated with oncogenic
Yufei Wang et al.
EMBO reports, 20(7), e47563-e47563 (2019-07-04)
Monoubiquitination of histone H2B on lysine 120 (H2Bub1) is an epigenetic mark generally associated with transcriptional activation, yet the global functions of H2Bub1 remain poorly understood. Ferroptosis is a form of non-apoptotic cell death characterized by the iron-dependent overproduction of
Eduardo de la Vega et al.
The FEBS journal, 287(21), 4659-4677 (2020-03-03)
Satellite cells (SCs) are myogenic progenitors responsible for skeletal muscle regeneration and maintenance. Upon activation, SCs enter a phase of robust proliferation followed by terminal differentiation. Underlying this myogenic progression, the sequential expression of muscle regulatory transcription factors (MRFs) and