Skip to Content
Merck

EHU134551

MISSION® esiRNA

targeting human NRP1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCCTGAACTACCCTGAGAATGGGTGGACTCCCGGAGAGGATTCCTACCGAGAGTGGATACAGGTAGACTTGGGCCTTCTGCGCTTTGTCACGGCTGTCGGGACACAGGGCGCCATTTCAAAAGAAACCAAGAAGAAATATTATGTCAAGACTTACAAGATCGACGTTAGCTCCAACGGGGAAGACTGGATCACCATAAAAGAAGGAAACAAACCTGTTCTCTTTCAGGGAAACACCAACCCCACAGATGTTGTGGTTGCAGTATTCCCCAAACCACTGATAACTCGATTTGTCCGAATCAAGCCTGCAACTTGGGAAACTGGCATATCTATGAGATTTGAAGTATACGGTTGCAAGATAACAGATTATCCTTGCTCTGGAATGTTGGGTATGGTGTCTGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... NRP1(8829)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pezhman Salehi et al.
PLoS genetics, 13(10), e1007048-e1007048 (2017-10-24)
Neuropilin-1 (Nrp1) encodes the transmembrane cellular receptor neuropilin-1, which is associated with cardiovascular and neuronal development and was within the peak SNP interval on chromosome 8 in our prior GWAS study on age-related hearing loss (ARHL) in mice. In this
Rebecca McLennan et al.
Developmental biology, 407(1), 12-25 (2015-08-19)
Embryonic neural crest cells travel in discrete streams to precise locations throughout the head and body. We previously showed that cranial neural crest cells respond chemotactically to vascular endothelial growth factor (VEGF) and that cells within the migratory front have
Toru Nakanishi et al.
Cell death & disease, 10(2), 67-67 (2019-01-27)
Following incomplete spinal cord injury (SCI), reorganization of the corticospinal tract (CST) contributes to spontaneous motor recovery. Axotomized CST fibers form collaterals and make synapses with interneurons, followed by pruning of excess fibers. Although axonal pruning is involved in refinement
Juan Cong Dong et al.
Journal of cellular and molecular medicine, 19(9), 2286-2295 (2015-07-07)
The purpose of this study was to determine the correlation between over-expression of the neuropilin 1 (NRP1) gene and growth, survival, and radio-sensitivity of non-small cell lung carcinoma (NSCLC) cells. 3-[4,5-dimethylthylthiazol-2-yl]-2,5 diphenyltetrazolium broide (MTT) and colony assays were then performed
Claudio Raimondi et al.
The Journal of experimental medicine, 211(6), 1167-1183 (2014-05-28)
To enable new blood vessel growth, endothelial cells (ECs) express neuropilin 1 (NRP1), and NRP1 associates with the receptor tyrosine kinase VEGFR2 after binding the vascular endothelial growth factor A (VEGF) to enhance arteriogenesis. We report that NRP1 contributes to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service