Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTGAAAGAGCAGGGCTTTGGCGGAGTCACAGATGCCATTGGAGCAGATCATCGGAGGTGAGGACAGCGTCTGACGGGAAGCCTGATCTGGAACCTTCCCAAGGACTCAGGCAAGCCTTTGTGGCTGGATCATGAGAGGAGGGACTCCATCTTGAGCCATGTCCCCCAGCCATGGCATGGCTGCACTGTAAACGCCAATCGGGGGGTCACCAGGATCAACCGCAGGCTTTCTTCAGTCCCTTGGTCAGACCATAAACTGCATTTTTGATTCTTTGTGGATTCAAACCCTAGGATCCATCAGTCTTGCAAGGACATTGAATATTAGGAGGAAAAAGTCATGGAAAAAATAAAGCCATTTAGAACCTGGGTTTCAACGCTAGCCCTTTCTGGTTTGCCATAGGCCCTGCCAAGATACTGCAGGTCCATCCAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DHODH(1723)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Deepti Mathur et al.
Cancer discovery, 7(4), 380-390 (2017-03-04)
Metabolic changes induced by oncogenic drivers of cancer contribute to tumor growth and are attractive targets for cancer treatment. Here, we found that increased growth of PTEN-mutant cells was dependent on glutamine flux through the de novo pyrimidine synthesis pathway
Xuemei Qiu et al.
International journal of oral science, 13(1), 3-3 (2021-01-30)
Oral squamous cell carcinoma (OSCC) become a heavy burden of public health, with approximately 300 000 newly diagnosed cases and 145 000 deaths worldwide per year. Nucleotide metabolism fuel DNA replication and RNA synthesis, which is indispensable for cell proliferation.
Mathura Subangari Dorasamy et al.
Journal of Cancer, 8(15), 3086-3098 (2017-09-21)
Dihydroorotate dehydrogenase (DHODH) is a rate-limiting enzyme in the