Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTCCTCTCACTCCAGCTCTGGGACACTGAGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCTGAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAGGATGGATTTGCCAATCTTGAATGTGTGAATGACAACTACTGGTTTGGGAGGGACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGAACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATTGCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAAGGAAAACGCCGTCCTTTGAAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CHEK2(11200)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
T-Y Chen et al.
Oncogenesis, 4, e180-e180 (2015-12-23)
The antitumor drug etoposide (ETO) is widely used in treating several cancers, including adrenocortical tumor (ACT). However, when used at sublethal doses, tumor cells still survive and are more susceptible to the recurring tumor due to centrosome amplification. Here, we
Thomas Ströbel et al.
Scientific reports, 7(1), 9674-9674 (2017-08-31)
Ape1 is the major apurinic/apyrimidinic (AP) endonuclease activity in mammalian cells, and a key factor in base-excision repair of DNA. High expression or aberrant subcellular distribution of Ape1 has been detected in many cancer types, correlated with drug response, tumor
Wei Liu et al.
Oncotarget, 9(1), 346-360 (2018-02-09)
Despite advances in deciphering the molecular pathogenesis of diffuse large B-cell lymphoma (DLBCL), patients with relapsed/refractory disease, particularly those with adverse genetic features (e.g., mutated p53 or double hit lymphoma (DHL)) have very poor prognoses, and effective therapies are lacking.