Skip to Content
Merck

EMU006511

MISSION® esiRNA

targeting mouse Dync2li1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Dync2li1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACTACGGAGCCTCGCTGATGTTTACCAGCAAGTCAGAAGCTCTGTTACTGAAGATACGCGGTGTTATCAACCAGTTGGCATTCGGTATTGATAAAAGCAAATCAATATGTGTGGATCAAAATAAGCCACTGTTTATCACAGCAGGACTGGATTCTTTATGTCAGATAGGGTCTCCTCCTGTTCCTGACAGTGACATTGGAAAACTTCAGGCCCACTCACCTATGGAGCTGTGGAAAAAGGTGTATGACAAGCTCTTCCCACCAAAGAGTACCGGCACCCTGAAGGCGGTCCAGGACCCAGCCCGAGACCCGCAGTATGCAGAAAGCGAAGTCGATGAGATGAGGGTTCAGAAGGACCAGGAACTAGAACACTACAAGAGAAGCTCCTCTAAGACCTGGAAGCAAATCGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kristin Kessler et al.
Scientific reports, 5, 11649-11649 (2015-07-02)
Skeletal ciliopathies are a heterogeneous group of autosomal recessive osteochondrodysplasias caused by defects in formation, maintenance and function of the primary cilium. Mutations in the underlying genes affect the molecular motors, intraflagellar transport complexes (IFT), or the basal body. The
S Paige Taylor et al.
Nature communications, 6, 7092-7092 (2015-06-17)
The short rib polydactyly syndromes (SRPSs) are a heterogeneous group of autosomal recessive, perinatal lethal skeletal disorders characterized primarily by short, horizontal ribs, short limbs and polydactyly. Mutations in several genes affecting intraflagellar transport (IFT) cause SRPS but they do

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service