Skip to Content
Merck

EMU024081

MISSION® esiRNA

targeting mouse Trim28

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATTCCCAGGATGCTAACCAGTGCTGCACTAGCTGTGAAGATAATGCCCCAGCCACTAGCTATTGTGTGGAGTGCTCTGAACCACTTTGTGAGACCTGTGTGGAGGCTCACCAGCGGGTGAAATACACCAAGGACCACACTGTGCGCTCCACAGGACCTGCTAAGACTCGAGATGGAGAGCGAACAGTCTACTGTAATGTGCACAAGCATGAGCCCCTCGTGCTGTTCTGTGAGAGCTGTGACACACTCACCTGCCGCGACTGCCAGCTCAACGCTCACAAGGACCATCAGTACCAGTTTTTGGAAGATGCAGTGAGGAACCAACGTAAACTCTTGGCTTCACTGGTGAAACGTCTTGGGGACAAACATGCCACACTTCAGAAAAACACCAAGGAGGTTCGAAGCTCGATCCGCCAGGTGTCTGATGTGCAGAAGCGAGTGCAGGTTGAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

A Bakr et al.
Nucleic acids research, 43(6), 3154-3166 (2015-03-11)
Ataxia-telangiectasia mutated (ATM) is needed for the initiation of the double-strand break (DSB) repair by homologous recombination (HR). ATM triggers DSB end resection by stimulating the nucleolytic activity of CtIP and MRE11 to generate 3'-ssDNA overhangs, followed by RPA loading
Estela Cruvinel et al.
Human molecular genetics, 23(17), 4674-4685 (2014-04-25)
Prader-Willi syndrome (PWS), a disorder of genomic imprinting, is characterized by neonatal hypotonia, hypogonadism, small hands and feet, hyperphagia and obesity in adulthood. PWS results from the loss of paternal copies of the cluster of SNORD116 C/D box snoRNAs and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service