Skip to Content
Merck

EMU039391

MISSION® esiRNA

targeting mouse Smad5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Smad5

Ensembl | mouse accession no.

NCBI accession no.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGATGGCCCCAGATAATTCCCAGCCTATGGATACAAGCAGTAACATGATTCCTCAGACCATGCCCAGCATATCCAGCAGAGATGTTCAGCCTGTCGCCTATGAGGAGCCCAAACACTGGTGTTCGATTGTCTACTATGAATTAAACAATCGTGTTGGGGAAGCTTTTCATGCATCTTCTACTAGTGTGTTAGTAGATGGATTTACAGATCCTTCAAATAACAAAAGTAGATTCTGCCTGGGATTGTTGTCAAATGTTAATCGTAATTCAACTATTGAAAACACTAGGCGGCATATTGGAAAAGGTGTTCATCTATACTACGTTGGTGGGGAGGTGTACGCTGAGTGTCTTAGTGACAGCAGCATCTTTGTTCAGAGTAGGAACTGCAACTTTCACCATGGCTTCCATCCCACCACCGTCTGTAAGATCCCCAGCAGCTGCAGCCTCAAGATTTTTAACAATCAGGAGTTTGCTCAGCTTCTGGCTCAGTCAGTCAACCATGGATTCGAGG

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Moyuan Deng et al.
Cell and tissue research, 361(3), 723-731 (2015-04-07)
Local application of bone morphogenetic protein 2 (BMP2) is known to promote large bone defect healing and BMP2-initiated bone regeneration could be enhanced by an additional mechanical stimulation. The C-terminal 24-a.a. peptide of mechano growth factor (MGF24E), a mechanical-sensitive molecule
Mingyue Nie et al.
Biology of reproduction, 93(4), 98-98 (2015-09-25)
In mammals, follicular atresia can be partially triggered by granulosa cell apoptosis. However, very little is known about the functions of miRNAs in granulosa cell apoptosis. We previously reported that hsa-mir-23a (miR-23a) and hsa-mir-27a (miR-27a) were highly expressed in the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service