Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAATTTGTTGGGGCATAAAGGTGAAGTGGCAGAAGAATTTGGTATAATCATGAAAGCCCTGTGGACAGGACAGTATAGATATATCAGTCCAAAGGACTTTAAAATCACCATTGGGAAGATCAATGACCAGTTTGCAGGATACAGTCAGCAAGATTCACAAGAATTGCTTCTGTTCCTAATGGATGGTCTCCATGAAGATCTAAATAAAGCTGATAATCGGAAGAGATATAAAGAAGAAAATAATGATCATCTCGATGACTTTAAAGCTGCAGAACATGCCTGGCAGAAACACAAGCAGCTCAATGAGTCTATTATTGTTGCACTTTTTCAGGGTCAATTCAAATCTACAGTACAGTGCCTCACATGTCACAAAAAGTCTAGGACATTTGAGGCCTTCATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... USP8(9101)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jinghui Zhang et al.
Biochimica et biophysica acta. General subjects, 1864(12), 129701-129701 (2020-08-21)
Background Organic anion transporter 1 (OAT1) plays a vital role in avoiding the potential toxicity of various anionic drugs through the involvement of kidney elimination. We previously demonstrated that ubiquitin conjugation to OAT1 led to OAT1 internalization from cell surface
Tania Martins-Marques et al.
Life science alliance, 3(12) (2020-10-25)
Ischemic heart disease has been associated with an impairment on intercellular communication mediated by both gap junctions and extracellular vesicles. We have previously shown that connexin 43 (Cx43), the main ventricular gap junction protein, assembles into channels at the extracellular
Soyeon Shin et al.
Cell death and differentiation, 27(4), 1341-1354 (2019-09-19)
Notch, an essential factor in tissue development and homoeostasis, has been reported to play an oncogenic function in a variety of cancers. Here, we report ubiquitin-specific protease 8 (USP8) as a novel deubiquitylase of Notch1 intracellular domain (NICD). USP8 specifically