Skip to Content
Merck

EMU074771

MISSION® esiRNA

targeting mouse Bcl2l11

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCGGAGACGAGTTCAACGAAACTTACACAAGGAGGGTGTTTGCAAATGATTACCGCGAGGCTGAAGACCACCCTCAAATGGTTATCTTACAACTGTTACGCTTTATCTTCCGTCTGGTATGGAGAAGGCATTGACAGGATCTACATGCAGCCAGGATACGTGGCGGACATGGCTCTTGTTCAGACTGGGAGAACCCCCACGCGTCATGTCCCTCTCTTGGTGCTGCGACAGTGTGTCCAGTGGTTCTATCCCAGAGAGATGTGCTGAGCATGGACAGCGCTCTGCACTGTGTCGATGTGAACGGAACCTCTGTTCATCACCACATGGCCGAGTTTTCAGTAAATATTTGTTGTGAATGTAAACAAGGGAGGGCTTTTCTCTTTTTAATGTACAGATCCTAGGAACAGAGAAATATGCAAGAGAGGTGTTTACATGTGGCGTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Oluwafunmilayo F Lamidi et al.
Journal of cancer research and clinical oncology, 141(9), 1575-1583 (2015-01-31)
Tubulysins are natural tetrapeptides that inhibit tubulin polymerisation. Tubulysins are very potent inhibitors of mammalian cancer cell growth, but restricted availability has limited their characterisation and development as anti-cancer compounds. KEMTUB10 was recently developed as a synthetic analogue of natural
Gong-Quan Li et al.
Oncotarget, 7(3), 2462-2474 (2015-11-18)
Bromodomain 4 (BRD4) is an epigenetic regulator that, when inhibited, has anti-cancer effects. In this study, we investigated whether BRD4 could be a target for treatment of human hepatocellular carcinoma (HCC). We show that BRD4 is over-expressed in HCC tissues.
S L Locatelli et al.
Leukemia, 28(9), 1861-1871 (2014-02-25)
Relapsed/refractory Hodgkin's lymphoma (HL) is an unmet medical need requiring new therapeutic options. Interactions between the histone deacetylase inhibitor Givinostat and the RAF/MEK/ERK inhibitor Sorafenib were examined in HDLM-2 and L-540 HL cell lines. Exposure to Givinostat/Sorafenib induced a synergistic