description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACAGAAAGTCACCGGTTTGGACTTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTCTACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTGGAGAACCTCCGGGATCTTCTTCACGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGGGGTGTCCTGGAAGCTTCAGGCTACTCCACAGAGGTGGTGGCCCTGAGCAGGCTGCAGGGGTCTCTGCAGGACATGCTGTGGCAGCTGGACCTCAGCCCTGGGTGCTGAGGCCTTGAAGGTCACTCTTCCTGCAAGGACTACGTTAAGGGAAGGAACTCTGGCTTCCAGGTATCTCCAGGATTGAAGAGCATTGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... LEP(3952)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
관련 콘텐츠
Instructions
Beniamin Oskar Grabarek et al.
International journal of molecular sciences, 22(4) (2021-02-11)
Psoriasis is a disease with a proinflammatory base, in which an increased expression of leptin, tumor necrosis factor alpha (TNF-α), interleukin (IL) IL-12/23, IL-6, is observed. A drug used in the treatment of psoriasis of moderate and acute strength is
Dariusz Dąbruś et al.
International journal of molecular sciences, 21(11) (2020-06-14)
This research aimed to assess the impact of cisplatin, depending on the concentration and exposure time, on the expression pattern of leptin in an endometrial cancer cell line. Ishikawa endometrial cancer cell cultures were incubated with cisplatin, at concentrations of
Amy L Strong et al.
Breast cancer research : BCR, 17, 112-112 (2015-08-20)
The steady increase in the incidence of obesity among adults has been paralleled with higher levels of obesity-associated breast cancer. While recent studies have suggested that adipose stromal/stem cells (ASCs) isolated from obese women enhance tumorigenicity, the mechanism(s) by which