description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCCAGAAACGAGCTCGAAGTGGGCCCCAGCCCAGACTGCCCCCCTGCCTGTTGCCCCTGAGCCCACCTACTGCTCCAGATCGTGCAACTGCTGTGGCCACTGCCTCCCGTCTTGGGCCCTATGTCCTCCTGGAGCCCGAGGAGGGCGGGCGGGCCTACCAGGCCCTGCACTGCCCTACAGGCACTGAGTATACCTGCAAGGTGTACCCCGTCCAGGAAGCCCTGGCCGTGCTGGAGCCCTATGCGCGGCTGCCCCCGCACAAGCATGTGGCTCGGCCCACTGAGGTCCTGGCTGGTACCCAGCTCCTCTACGCCTTTTTCACTCGGACCCATGGGGACATGCACAGCCTGGTGCGAAGCCGCCACCGTATCCCTGAGCCTGAGGCTGCCGTGCTCTTCCGCCAGATGGCCACCGCCCTGGCGCACTGTCACCAGCACGGTCTGGTCCTGCGTGATCTCAAGCTGTGTCGCTTTGTCTTCGCTGACCGTGAGAGGAAGAAGCTGGTGCTGGAGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TRIB3(57761)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
관련 콘텐츠
Instructions
Anna López-Plana et al.
International journal of cancer, 147(4), 1163-1179 (2020-01-17)
Around 40% of newly diagnosed lung cancer patients are Stage IV, where the improvement of survival and reduction of disease-related adverse events is the main goal for oncologists. In this scenario, we present preclinical evidence supporting the use of ABTL0812
Seong-Hoon Yun et al.
Oncotarget, 9(1), 495-511 (2018-02-09)
We previously demonstrated that the quinovose-containing hexaoside stichoposide C (STC) is a more potent anti-leukemic agent than the glucose-containing stichoposide D (STD), and that these substances have different molecular mechanisms of action. In the present study, we investigated the novel
Shuyi Wang et al.
Biochimica et biophysica acta, 1863(12), 3060-3074 (2017-09-25)
Endoplasmic reticulum (ER) stress has been demonstrated to prompt various cardiovascular risks although the underlying mechanism remains elusive. Protein tyrosine phosphatase-1B (PTP1B) serves as an essential negative regulator for insulin signaling. This study examined the role of PTP1B in ER