콘텐츠로 건너뛰기
Merck

EHU025841

MISSION® esiRNA

targeting human HDAC1

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택


제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HDAC1(3065)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Soniya Bastola et al.
Nature communications, 11(1), 4660-4660 (2020-09-18)
Intratumor spatial heterogeneity facilitates therapeutic resistance in glioblastoma (GBM). Nonetheless, understanding of GBM heterogeneity is largely limited to the surgically resectable tumor core lesion while the seeds for recurrence reside in the unresectable tumor edge. In this study, stratification of
Jing Yang et al.
Scientific reports, 7, 43864-43864 (2017-03-07)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed cancers in the world. Elevated glucose metabolism in the availability of oxygen, a phenomenon called the Warburg effect, is important for cancer cell growth. Fructose-1,6-bisphosphatase (FBP1) is a rate-limiting enzyme
Chaojie Hu et al.
Journal of leukocyte biology, 101(3), 633-642 (2016-06-05)
Binge drinking represses host innate immunity and leads to a high risk of infection. Acute EtOH-pretreated macrophages exhibit a decreased production of proinflammatory mediators in response to LPS. ATF3 is induced and counter-regulates the LPS/TLR4 inflammatory cascade. Here, we investigated
Baojie Zhang et al.
Cancers, 11(5) (2019-05-15)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is considered as a promising anti-cancer therapeutic. However, many cancers have been found to be or to become inherently resistant to TRAIL. A combination of epigenetic modifiers, such as histone deacetylase inhibitors (HDACi's), with
He Huang et al.
Cell research, 28(1), 111-125 (2017-12-02)
Short-chain fatty acids and their corresponding acyl-CoAs sit at the crossroads of metabolic pathways and play important roles in diverse cellular processes. They are also precursors for protein post-translational lysine acylation modifications. A noteworthy example is the newly identified lysine

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.