description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGAATTTGGATCCCGTACCACTTAGACATCTACTTAATCTGGTCTCAGCTCTTGAGCCAAGTGTTCATACTGAACAGACACTGTACTTGGCATCCATGTTAATTAAAGCACTGTGGAATAACGCACTAGCAGCTAAGGCTCAGTTATCTAAACAGAGTTCTTTTGCATCTTTATTAAATACTAATATTCCCATTGGAAATAAGAAAGAGGAAGAAGAGCTTAGAAGAACAGCTCCATCACCTTGGTCACCTGCAGCTAGTCCTCAAAGCAGTGATAATAGCGATACACATCAAAGTGGAGGTAGTGACATTGAAATGGATGAGCAACTTATTAATAGAACCAAACATGTGCAACAACGACTTTCAGACACAGAGGAATCCATGCAGGGAAGTTCTGACGAAACTGCCAACAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... USP34(9736)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Qiwen Li et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 35(8), 1597-1608 (2020-03-27)
The ubiquitination and deubiquitination enzymes ensure the stability and proper function of most cellular proteins. Disturbance of either enzyme compromises tissue homeostasis. We recently have identified that the ubiquitin-specific protease 34 (USP34) contributes to bone formation by promoting osteogenic differentiation