콘텐츠로 건너뛰기
Merck

EHU070231

MISSION® esiRNA

targeting human SLC7A11

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택


제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTTTGTTGCCCTCTCCTGCTTTGGCTCCATGAACGGTGGTGTGTTTGCTGTCTCCAGGTTATTCTATGTTGCGTCTCGAGAGGGTCACCTTCCAGAAATCCTCTCCATGATTCATGTCCGCAAGCACACTCCTCTACCAGCTGTTATTGTTTTGCACCCTTTGACAATGATAATGCTCTTCTCTGGAGACCTCGACAGTCTTTTGAATTTCCTCAGTTTTGCCAGGTGGCTTTTTATTGGGCTGGCAGTTGCTGGGCTGATTTATCTTCGATACAAATGCCCAGATATGCATCGTCCTTTCAAGGTGCCACTGTTCATCCCAGCTTTGTTTTCCTTCACATGCCTCTTCATGGTTGCCCTTTCCCTCTATTCGGACCCATTTAGTACAGGGATTGGCTTCGTCATCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... SLC7A11(23657)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Naisu Yang et al.
Journal of genetics, 97(2), 463-468 (2018-06-23)
Solute carrier family 7 member 11 (SLC7A11) is a cystine/glutamate exchanger, also known as xCT, has been found to play an important role in pheomelanin synthesis. Adjusting the cystine content of cells to influence pheomelanin synthesis affects the proportion of
Masaki Nagane et al.
PloS one, 13(4), e0195151-e0195151 (2018-04-13)
The sodium-independent cystine-glutamate antiporter plays an important role in extracellular cystine uptake. It comprises the transmembrane protein, xCT and its chaperone, CD98. Because glutathione is only weakly cell membrane permeable, cellular uptake of its precursor, cystine, is known to be
Yu Li et al.
Oncology letters, 19(1), 323-333 (2020-01-04)
Non-small cell lung cancer (NSCLC) has long been one of the most lethal types of cancer due to its lack of typical clinical symptoms at early stages and high risk of tumour recurrence, even following complete surgical resection. Multicourse chemotherapy
Chaoli Huang et al.
Oncology reports, 40(4), 2363-2370 (2018-08-02)
The tumour‑suppressor protein p53 is a key regulator of multiple cellular processes and exerts its tumour‑suppressor function by inducing apoptotic cell death. However, emerging evidence indicates that p53 is also involved in inducing ferroptosis, which is a unique iron‑dependent form
Chun Ge et al.
Scientific reports, 7(1), 3791-3791 (2017-06-21)
Adriamycin (ADR) induces the over-expression of P-glycoprotein (P-gp) and multiple drug resistance in breast cancer cells. However, the biochemical process and underlying mechanisms are not clear. Our previous study revealed that ADR increased reactive oxygen species (ROS) generation and decreased

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.