콘텐츠로 건너뛰기
Merck

EHU078041

MISSION® esiRNA

targeting human PMAIP1

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택


제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCTCAGGAGGTGCACGTTTCATCAATTTGAAGAAAGACTGCATTGTAATTGAGAGGAATGTGAAGGTGCATTCATGGGTGCCCTTGGAAACGGAAGATGGAATACATCAAAGTGAATTTCTGTTCAAGTTTTCCCAGATTATCATTCTTTGGGATGAGAGAACATTATAAAACCACTTTGTTTATTTTAAAGCAAGAATGGAAGACCCTTGAAAATAAAGAAGTAATTATTGACACATTTCTTTTTTACTTAGAGAATCGTTCTAGTGTTTTTGCCGAAGATTACCGCTGGCCTACTGTGAAGGGAGATGACCTGTGATTAGACTGGGCGGCTGGGGAGAAACAGTTCAGTGCATTGTTGTTGTTGCTGTTTTTGGTGTTTTGCTTTTCAGTGCCAACTCAGCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... PMAIP1(5366)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhenqian Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 95, 1574-1579 (2017-09-28)
Colorectal cancer (CRC) cells undergo apoptosis in the presence of the small-molecule inhibitor ABT-263 by up-regulating antiapoptotic Bcl-2 family members. However, the resistance to ABT-263 gradually developed in most solid tumors due to its low affinity to Mcl-1. Here, we
Eugene Y Kim et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, fj201800425R-fj201800425R (2018-05-26)
Rheumatoid arthritis (RA) is characterized by hyperplastic pannus formation mediated by activated synovial fibroblasts (RASFs) that cause joint destruction. We have shown earlier that RASFs exhibit resistance to apoptosis, primarily as a result of enhanced expression of myeloid cell leukemia-1
Yohei Sugimoto et al.
Molecular cancer therapeutics, 19(10), 1992-2000 (2020-08-28)
Rhabdoid tumor is an aggressive, early childhood tumor. Biallelic inactivation of the SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 (SMARCB1)/integrase interactor 1 (INI1) gene is the only common genetic feature in rhabdoid tumors. Loss of SMARCB1 function
Patricia Gomez-Bougie et al.
Cancer letters, 383(2), 204-211 (2016-10-25)
As myeloma cells actively produce and secrete immunoglobulins, they are prone to ER stress, which if unresolved leads to apoptosis. We found that myeloma cell death induced by the ER stressor Thapsigargin was highly variable, ranging from 2 to 89%.
Yoon A Jeong et al.
Nutrients, 11(9) (2019-09-01)
Although the anticancer activity of Korean Red Ginseng (KRG) has been known in various cancers, the mechanism of KRG-induced apoptosis is unknown in colorectal cancer (CRC). In our study, we examined whether KRG induces apoptosis in CRC cells. In the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.