description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCTTCACAGAGAAGGCTGTGGTTCCCCTGGGCCTCTACACTGGGCAGCTGGCCCTGAACTGGGCATGGCCCCCCATCTTCTTTGGTGCCCGACAAATGGGCTGGGCCTTGGTGGATCTCCTGCTGGTCAGTGGGGCGGCGGCAGCCACTACCGTGGCCTGGTACCAGGTGAGCCCGCTGGCCGCCCGCCTGCTCTACCCCTACCTGGCCTGGCTGGCCTTCACGACCACACTCAACTACTGCGTATGGCGGGACAACCATGGCTGGCGTGGGGGACGGCGGCTGCCAGAGTGAGTGCCCGGCCCACCAGGGACTGCAGCTGCACCAGCAGGTGCCATCACGCTTGTGATGTGGTGGCCGTCACGCTTTCATGACCACTGGGCCTGCTAGTCTGTCAGGGCCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
human ... TSPO(706)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Shanfei Ge et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 942-951 (2017-06-18)
Growth Factor Receptor-bound 2 (GRB2) plays a crucial role in regulation of cellular function including proliferation and differentiation, and we previously identified GRB2 as promoting HSCs (HSCs) proliferation. However, the underlying mechanisms that are involving in the regulation of GRB2
Eleonora Da Pozzo et al.
International journal of molecular sciences, 20(18) (2019-09-13)
A key role of the mitochondrial Translocator Protein 18 KDa (TSPO) in neuroinflammation has been recently proposed. However, little is known about TSPO-activated pathways underlying the modulation of reactive microglia. In the present work, the TSPO activation was explored in
Lian-Pan Wu et al.
Acta pharmacologica Sinica, 41(1), 34-46 (2019-09-14)
Abnormal growth of the intimal layer of blood vessels (neointima formation) contributes to the progression of atherosclerosis and in-stent restenosis. Recent evidence shows that the 18-kDa translocator protein (TSPO), a mitochondrial membrane protein, is involved in diverse cardiovascular diseases. In
Vladimir M Milenkovic et al.
International journal of molecular sciences, 20(13) (2019-07-22)
The 18 kDa translocator protein (TSPO) is an evolutionary conserved cholesterol binding protein localized in the outer mitochondrial membrane. It has been implicated in the regulation of various cellular processes including oxidative stress, proliferation, apoptosis, and steroid hormone biosynthesis. Since
Stefanie Bader et al.
Psychoneuroendocrinology, 106, 65-76 (2019-04-08)
The translocator protein 18 kDa (TSPO), initially characterized as peripheral benzodiazepine receptor, is a conserved outer mitochondrial membrane protein, implicated in cholesterol transport thereby affecting steroid hormone biosynthesis, as well as in general mitochondrial function related to bioenergetics, oxidative stress, and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.