description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGGGGTTTATTTCAGCAAACTTGTTGAATTTATTTTTAAGAAAGAAATACTGTATTGGGAAGTTACTGTTACTTGATAACAATGTTTTAACAAGAAGCAATGTTATAAAGTTAGTTTCAGTGCATTATCTACTTGTGTAGTCCTATGCAATAACAGTAGTGTTACATGTATCAAGCCTAGATGTTTTATACAGATGCCATATAGTGTTATGAGCCAGGCTGTTGAATGGAATTTCTCAGTAGCAGCCTACAACTGAATAGCAAGTGGCATAAAGCATATCCATTCAGAATGAAGTGCCTTAAATATAGCAGTAGTCTTTTTTGGACTAGCACTGACTGAACTGTAATGTAGGGGAAAGTTTCATGATGGTATCTATAGTCAAGACGAACATGTAGCATGGTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MITF(4286)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Paola Falletta et al.
Genes & development, 31(1), 18-33 (2017-01-18)
The intratumor microenvironment generates phenotypically distinct but interconvertible malignant cell subpopulations that fuel metastatic spread and therapeutic resistance. Whether different microenvironmental cues impose invasive or therapy-resistant phenotypes via a common mechanism is unknown. In melanoma, low expression of the lineage
Yue Chang et al.
Cancer cell international, 21(1), 29-29 (2021-01-09)
Endometrial cancer is an invasive gynecological cancer prevalent in the world. The pathogenesis of endometrial cancer is related to multiple levels of regulation, referring to oestrogen, tumor-suppressor gene (e.g. PTEN) or microRNAs (e.g. miR-23a and miR-29b). Metapristone is a hormone-related
Megha Rajasekhar et al.
Scientific reports, 8(1), 7264-7264 (2018-05-10)
Myelopoiesis involves differentiation of hematopoietic stem cells to cellular populations that are restricted in their self-renewal capacity, beginning with the common myeloid progenitor (CMP) and leading to mature cells including monocytes and granulocytes. This complex process is regulated by various