description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACCCCAACTCCAGAGACCTTCCTGACCACAATCCGGGATGAGCCAGAGGTTCCGGTGAGTGGGGGGCCCAGTGGAGACTTCGAGCTGCCAGAAGAAGAGACCACACAACCAGACACAGCCAATGAGGTGGTAGCTGTGGGAGGGGCTGCGGCCAAGGCATCATCTCCACCTGGGACACTGCCCAAGGGTGCCCGCCCGGGCCCTGGCCTCCTGGACAATGCCATCGACTCGGGCAGCTCAGCTGCTCAGCTGCCTCAGAAGAGTATCCTGGAGCGGAAGGAGGTGCTCGTAGCTGTGATTGTGGGCGGGGTGGTGGGCGCCCTCTTTGCTGCCTTCTTGGTCACACTGCTCATCTATCGTATGAAGAAAAAGGATGAGGGCAGCTACACGCTGGAGGAACCCAAGCAGGCGAGCGTCACATACCAGAAGCCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SDC3(9672)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Anissa Kempf et al.
Developmental cell, 43(1), 24-34 (2017-09-26)
Heparan sulfate proteoglycans (HSPGs) critically modulate adhesion-, growth-, and migration-related processes. Here, we show that the transmembrane protein, Nogo-A, inhibits neurite outgrowth and cell spreading in neurons and Nogo-A-responsive cell lines via HSPGs. The extracellular, active 180 amino acid Nogo-A
Erik H Knelson et al.
The Journal of clinical investigation, 124(7), 3016-3031 (2014-06-18)
Neuroblastoma prognosis is dependent on both the differentiation state and stromal content of the tumor. Neuroblastoma tumor stroma is thought to suppress neuroblast growth via release of soluble differentiating factors. Here, we identified critical growth-limiting components of the differentiating stroma