description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTTGTGAAACTTGAAAGAGAATAGACAGTATGACATATAGAATTAATACAAAACAGTTTAACAACCATTTAACTGCAGTGTAAGAAAATTGGACTGTAATCATATCGCTACTGGCATCTGTTATCTAGTATGCATTTCTGGTGTGTATCTGAAAGGAAGACATTTTCTACCCTAGATCCAATTGCATTTATTTATCAATAAGTGCCATTAAATTGAAATTATATTACATTTTACACTTTCTCAATGAATGAACAAATTAGTCTGTAGAATCTAGCCACCTGTTTAGCCTAGTCATGTGCCTTGAACATATATGTGTCCCATAATCTGGCTCATGGTACCTGTTCTTCTATCCAAACCTTTCAATTCATGCTACCTGATTCATTTATTTGACATAGATCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... VAMP7(6845)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Praneeth Chitirala et al.
Frontiers in immunology, 10, 1855-1855 (2019-08-27)
Cytotoxic T lymphocytes kill infected or malignant cells through the directed release of cytotoxic substances at the site of target cell contact, the immunological synapse. While genetic association studies of genes predisposing to early-onset life-threatening hemophagocytic lymphohistiocytosis has identified components
Juan José Saez et al.
Cells, 10(2) (2021-02-13)
LAT is an important player of the signaling cascade induced by TCR activation. This adapter molecule is present at the plasma membrane of T lymphocytes and more abundantly in intracellular compartments. Upon T cell activation the intracellular pool of LAT
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.