description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCAGCCAGACAGCTACTTCAGCGTCCTCAACGCATTCATCGACAGGAAGGACAGTTACTACTCCATTCACCAGATAGCGCAAATGGGAGTTGGCGAAGGCAAGTCCATAGGCCAGTGGTACGGGCCCAACACTGTCGCCCAGGTCCTGAAGAAGCTTGCTGTCTTCGATACGTGGAGCTCCTTGGCGGTCCACATTGCAATGGACAACACTGTTGTGATGGAGGAAATCAGAAGGTTGTGCAGGACCAGCGTTCCCTGTGCAGGCGCCACTGCGTTTCCTGCAGATTCCGACCGGCACTGCAACGGATTCCCTGCCGGAGCTGAGGTCACCAACAGGCCGTCGCCATGGAGACCCCTGGTACTTCTCATTCCCCTGCGCCTGGGGCTCACGGACATCAACGAGGCCTACGT
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ATG4B(23192)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Yao-Xin Lin et al.
Biomaterials, 141, 199-209 (2017-07-10)
Autophagic therapy is regarded as a promising strategy for disease treatment. Appropriate autophagy regulations in vivo play a crucial role in translating this new concept from benchside to bedside. So far, emerging technologies are required to spatially and quantitatively monitor autophagic
Pei-Feng Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 728-740 (2017-11-24)
ATG4B is a cysteine protease required for autophagy, which is a cellular catabolic pathway involved in energy balance. ATG4B expression is elevated during tumor growth in certain types of cancer, suggesting that ATG4B is an attractive target for cancer therapy.
Yao-Xin Lin et al.
ACS nano, 11(2), 1826-1839 (2017-01-24)
Autophagy plays a crucial role in the metabolic process. So far, conventional methods are incapable of rapid, precise, and real-time monitoring of autophagy in living objects. Herein, we describe an in situ intracellular self-assembly strategy for quantitative and temporal determination