description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAAGACGAGCAAGACACACACAGATACTGAAAGTGAAGCAAGCATCTTGGGAGACAGCGGGGAGTACAAGATGATTCTTGTGGTTCGAAATGACTTAAAGATGGGAAAAGGGAAAGTGGCTGCCCAGTGCTCTCATGCTGCTGTTTCAGCCTACAAGCAGATTCAAAGAAGAAATCCTGAAATGCTCAAACAATGGGAATACTGTGGCCAGCCCAAGGTGGTGGTCAAAGCTCCTGATGAAGAAACCCTGATTGCATTATTGGCCCATGCAAAAATGCTGGGACTGACTGTAAGTTTAATTCAAGATGCTGGACGTACTCAGATTGCACCAGGCTCTCAAACTGTCCTAGGGATTGGGCCAGGACCAGCAGACCTAATTGACAAAGTCACTGGTCACCTAAAACTTTACTAGGTGGACTTTGATATGACAACAACCCCTCCATCACAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
human ... PTRH2(51651)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Yan Liu et al.
Human cell, 32(4), 418-427 (2019-08-02)
Studies have shown that astrocyte plays an important role in the formation of retinal vasculature during development. For our study, we investigated the role of Bcl2 inhibitor of transcription 1 (Bit1) in regulating astrocyte function from developing retina and its
Xin Yao et al.
PloS one, 9(7), e101564-e101564 (2014-07-09)
The mitochondrial Bit1 (Bcl-2 inhibitor of transcription 1) protein is a part of an apoptotic pathway that is uniquely regulated by integrin-mediated attachment. As an anoikis effector, Bit1 is released into the cytoplasm following loss of cell attachment and induces
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.