콘텐츠로 건너뛰기
Merck

EHU114351

MISSION® esiRNA

targeting human PTRH2

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택


제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGACGAGCAAGACACACACAGATACTGAAAGTGAAGCAAGCATCTTGGGAGACAGCGGGGAGTACAAGATGATTCTTGTGGTTCGAAATGACTTAAAGATGGGAAAAGGGAAAGTGGCTGCCCAGTGCTCTCATGCTGCTGTTTCAGCCTACAAGCAGATTCAAAGAAGAAATCCTGAAATGCTCAAACAATGGGAATACTGTGGCCAGCCCAAGGTGGTGGTCAAAGCTCCTGATGAAGAAACCCTGATTGCATTATTGGCCCATGCAAAAATGCTGGGACTGACTGTAAGTTTAATTCAAGATGCTGGACGTACTCAGATTGCACCAGGCTCTCAAACTGTCCTAGGGATTGGGCCAGGACCAGCAGACCTAATTGACAAAGTCACTGGTCACCTAAAACTTTACTAGGTGGACTTTGATATGACAACAACCCCTCCATCACAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... PTRH2(51651)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yan Liu et al.
Human cell, 32(4), 418-427 (2019-08-02)
Studies have shown that astrocyte plays an important role in the formation of retinal vasculature during development. For our study, we investigated the role of Bcl2 inhibitor of transcription 1 (Bit1) in regulating astrocyte function from developing retina and its
Xin Yao et al.
PloS one, 9(7), e101564-e101564 (2014-07-09)
The mitochondrial Bit1 (Bcl-2 inhibitor of transcription 1) protein is a part of an apoptotic pathway that is uniquely regulated by integrin-mediated attachment. As an anoikis effector, Bit1 is released into the cytoplasm following loss of cell attachment and induces

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.