콘텐츠로 건너뛰기
Merck

EHU114901

MISSION® esiRNA

targeting human ATF4

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택


제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACAACAGCAAGGAGGATGCCTTCTCCGGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTGGGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTGACCACGTTGGATGACACTTGTGATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAGACGGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCTTCTTACAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAGGAAGCCAGACTACACTGCTTACGTTGCCATGATCCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... ATF4(468)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yoko Tabe et al.
Scientific reports, 8(1), 16837-16837 (2018-11-18)
Adipocytes are the prevalent stromal cell type in adult bone marrow (BM), and leukemia cells continuously adapt to deficiency of nutrients acquiring chemoresistant profiles in the BM microenvironment. We have previously shown that fatty acid metabolism is a key energy
Ritesh K Srivastava et al.
Toxicology and applied pharmacology, 308, 46-58 (2016-07-28)
Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here
Zhen Ren et al.
Toxicological sciences : an official journal of the Society of Toxicology, 154(2), 368-380 (2016-09-11)
Nefazodone, an antagonist for the 5-hydroxytryptanine receptor, has been used for the treatment of depression. Acute liver injury has been documented to be associated with the use of nefazodone; however, the mechanisms of nefazodone-induced liver toxicity are not well defined.
Qifei Wang et al.
Die Pharmazie, 73(3), 156-160 (2018-03-17)
Previous studies have shown sorafenib to function as a multitargeted tyrosine kinase inhibitor in different tumors. However, whether sorafenib improves renal cell carcinoma (RCC) through activating transcription factor 4 (ATF4) has never been explored. In the current study, we showed
Hao Chen et al.
Oncology research, 27(3), 325-334 (2018-05-03)
It is well known that activating transcription factor 4 (ATF4) expression is closely associated with progression of many cancers. We found that miR-1283 could directly target ATF4. However, the precise mechanisms of miR-1283 in glioma have not been well clarified.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.