description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCATGCTGCTGGACAAGAACGTGCCCAACCCACGAATCAAGCTCATCGACTTCGGCATCGCGCACAAGATCGAGGCGGGGAACGAGTTCAAGAACATCTTCGGCACCCCGGAGTTTGTGGCCCCAGAGATTGTGAACTATGAGCCGCTGGGCCTGGAGGCGGACATGTGGAGCATCGGTGTCATCACCTATATCCTCCTGAGCGGTGCATCCCCGTTCCTGGGCGAGACCAAGCAGGAGACGCTCACCAACATCTCAGCCGTGAACTACGACTTCGACGAGGAGTACTTCAGCAACACCAGCGAGCTGGCCAAGGACTTCATTCGCCGGCTGCTCGTCAAAGATCCCAAGCGGAGAATGACCATTGCCCAGAGCCTGGAACATTCCTGGATTAAGGCGATCCGGCGGCGGAACGTGCGTGGTGAGGACAGCGGCCGCAAGCCCGAGCGGCGGCGCCTGAAGACCACGCGTCTGAAGGAGTACACCATCAAGTCGCACTCCAGCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DAPK3(1613)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Ke-Xue Li et al.
European journal of pharmacology, 852, 90-98 (2019-03-10)
Vascular calcification (VC) is a critical feature of chronic kidney disease (CKD), diabetes, hypertension, and atherosclerosis. Death-associated protein kinase 3 (DAPK3) is involved in vascular remodeling in hypertension. However, it remains to be clarified whether DAPK3 controls vascular smooth muscle
Jing-Ti Deng et al.
PloS one, 14(12), e0226406-e0226406 (2019-12-14)
Myosin regulatory light chain (LC20) phosphorylation plays an important role in vascular smooth muscle contraction and cell migration. Ca2+/calmodulin-dependent myosin light chain kinase (MLCK) phosphorylates LC20 (its only known substrate) exclusively at S19. Rho-associated kinase (ROCK) and zipper-interacting protein kinase