description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACCTGTCTGTCCCTGGTGTGGAGCATGAAGCCCGTGTTCCCAAGAAAATCCTCAAGTGCAAGGCAGTGTCTCGAGAACTTAATTTTTCTTCGACAGAACAAATGGAAAAATTCCGCCTGGAACAAAAAGTTTACTTCAAAGGGCAATGCCTAGAAGAATGGTTCTTCGAGTTTGGCTTTGTGATCCCTAACTCCACAAATACCTGGCAGTCCTTGATAGAGGCAGCACCCGAGTCCCAGATGATGCCAGCAAGCGTCTTAACTGGGAACGTTATCATAGAAACAAAGTTTTTTGACGACGATCTTCTTGTAAGCACATCCAGAGTGAGACTTTTCTATGTTTGAAAGAAGAATGTGTGTACATTTCAAGAATTTGGGTTTTTTGGAGGGAGGAGGAAACT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
human ... PDE6D(5147)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Sevdalina Nikolova et al.
Respiratory research, 11, 146-146 (2010-10-29)
Idiopathic Pulmonary Fibrosis (IPF) is an unresolved clinical issue. Phosphodiesterases (PDEs) are known therapeutic targets for various proliferative lung diseases. Lung PDE6 expression and function has received little or no attention. The present study aimed to characterize (i) PDE6 subunits
Michael Dumbacher et al.
Molecular neurodegeneration, 13(1), 50-50 (2018-09-28)
Neuronal Ca2+ dyshomeostasis and hyperactivity play a central role in Alzheimer's disease pathology and progression. Amyloid-beta together with non-genetic risk-factors of Alzheimer's disease contributes to increased Ca2+ influx and aberrant neuronal activity, which accelerates neurodegeneration in a feed-forward fashion. As
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.