description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ESR1(2099)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Shan Gao et al.
Frontiers in oncology, 10, 753-753 (2020-06-06)
Background: Dysregulation of ESR1 accounts for endocrine therapy resistance and metastasis of ERα positive breast cancer. However, the underlying molecular mechanism of ESR1 in ERα positive breast cancer remains insufficiency. Notably, to date, a comprehensive miRNA-mRNA regulatory network involved in
Keivan Mobini et al.
Journal of biochemical and molecular toxicology, e22304-e22304 (2019-02-20)
The underlying functions of miR-206, miR-133a, miR-27b, and miR-21, and their link to the estrogen receptor alpha (ERα) and aryl hydrocarbon receptor (AhR) signaling pathways remain largely unexplored. In this study, we detect the expression of miR-206, miR-133a, miR-27b, and
Fang Liu et al.
Molecular diagnosis & therapy, 22(5), 551-569 (2018-06-22)
Small interfering RNAs (siRNAs) are an attractive new agent with potential as a therapeutic tool because of its ability to inhibit specific genes for many conditions, including viral infections and cancers. However, despite this potential, many challenges remain, including off-target