콘텐츠로 건너뛰기
Merck

EHU141651

MISSION® esiRNA

targeting human ESR1

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택

보기 변경

제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ESR1(2099)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문



Shan Gao et al.
Frontiers in oncology, 10, 753-753 (2020-06-06)
Background: Dysregulation of ESR1 accounts for endocrine therapy resistance and metastasis of ERα positive breast cancer. However, the underlying molecular mechanism of ESR1 in ERα positive breast cancer remains insufficiency. Notably, to date, a comprehensive miRNA-mRNA regulatory network involved in
Keivan Mobini et al.
Journal of biochemical and molecular toxicology, e22304-e22304 (2019-02-20)
The underlying functions of miR-206, miR-133a, miR-27b, and miR-21, and their link to the estrogen receptor alpha (ERα) and aryl hydrocarbon receptor (AhR) signaling pathways remain largely unexplored. In this study, we detect the expression of miR-206, miR-133a, miR-27b, and
Fang Liu et al.
Molecular diagnosis & therapy, 22(5), 551-569 (2018-06-22)
Small interfering RNAs (siRNAs) are an attractive new agent with potential as a therapeutic tool because of its ability to inhibit specific genes for many conditions, including viral infections and cancers. However, despite this potential, many challenges remain, including off-target