description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCACGAGGTGTCAGAGATCATCGATGGCCTCTCAGAGCAGGAGAACCTGGAGAAGCAGATGCGCCAGCTGGCCGTGATCCCGCCCATGCTGTACGACGCTGACCAGCAGCGCATCAAGTTCATCAACATGAACGGGCTTATGGCCGACCCCATGAAGGTGTACAAAGACCGCCAGGTCATGAACATGTGGAGTGAGCAGGAGAAGGAGACCTTCCGGGAGAAGTTCATGCAGCATCCCAAGAACTTTGGCCTGATCGCATCATTCCTGGAGAGGAAGACAGTGGCTGAGTGCGTCCTCTATTACTACCTGACTAAGAAGAATGAGAACTATAAGAGCCTGGTGAGACGGAGCTATCGGCGCCGCGGCAAGAGCCAGCAGCAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCCATGCCCCGCAGCAGCCAGGAGGAGAAAGATGAGAAGGAGAAGGAAAAGGAGGCGGAGAAGGAGGAGGAGAAGCCGGAGGTGGAGAACGACAAGGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Ligand Activation of PPARγ by Ligustrazine Suppresses Pericyte Functions of Hepatic Stellate Cells via SMRT-Mediated Transrepression of HIF-1α.
Feng Zhang et al.
Theranostics, 8(3), 610-626 (2018-01-19)
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Jil Sander et al.
Immunity, 47(6), 1051-1066 (2017-12-21)
Human in vitro generated monocyte-derived dendritic cells (moDCs) and macrophages are used clinically, e.g., to induce immunity against cancer. However, their physiological counterparts, ontogeny, transcriptional regulation, and heterogeneity remains largely unknown, hampering their clinical use. High-dimensional techniques were used to elucidate transcriptional, phenotypic
Nikhil Sharma et al.
Neuron, 102(2), 390-406 (2019-03-09)
Neuronal activity-dependent transcription is tuned to ensure precise gene induction during periods of heightened synaptic activity, allowing for appropriate responses of activated neurons within neural circuits. The consequences of aberrant induction of activity-dependent genes on neuronal physiology are not yet
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.