description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGGCACTTGGAGAGGCTGTACTTGGACCACAACAACCTGACCCGGATGCCCGGCCCGCTGCCCCGATCCCTGAGAGAGCTCCACCTGGACCACAACCAGATCTCACGGGTCCCCAACAATGCTTTGGAGGGCCTGGAGAACCTCACGGCCTTATATCTCCACCACAATGAGATCCAGGAAGTGGGGAGTTCCATGAGAGGCCTCCGGTCCCTGATCCTACTAGACCTGAGTTATAACCACCTTCGGAGGGTACCCGACGGTCTGCCCTCAGCCCTGGAGCAGCTGTACCTAGAACACAACAATGTCTACACCGTCCCTGACAGCTACTTCCGGGGGTCACCCAAGCTGCTGTACGTCCGGTTGTCTCACAACAGTCTCACTAACAACGGCCTTGCTACCAACACCTTCAACTCCAGCA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... FMOD(14264), Fmod(14264)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Guanmei Wen et al.
The Journal of biological chemistry, 290(31), 19158-19172 (2015-06-21)
Matrix metalloproteinase-8 (MMP8) has been shown to influence various cellular functions. As monocytes and macrophages (Mφ) express MMP8, we investigated if MMP8 played a role in macrophage differentiation and polarization. MMP8 expression was significantly increased during monocyte differentiation into Mφ.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.