description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AACTCCGGAGGATTGGAGACAAAGTGAATTTACGGCAGAAACTTCTGAATTTGATTTCCAAGCTCTTCAATTTAGTAACCTGAGTTCTTCCAAAGCTTTTGCAAGAAGGGACCTCCCAGGAAGGAAGTTCCGCCGGTTGATGGAAATGCCTGGTATTGGATGGATTGTGATGTGATGAGAGAAACGCTCGCTTGCTTTTGGTTCCCTGAGCAGGGATGATGAAGGAGATAGGAATGAGTTTCTTTCGGAAAGTTTTCAGAAATCGTTCTTTGAGCTGTGATAACGTGAAACCACACTTGTTTTTACTTTTATTATTATTTTTTTGAAGAGTCGTGGAGCTAGGGAAGTAACTAGTAATAATCTATCTTTTTAGAGTTGTTCTGGTTGTTTTTGCCAAAGGTTGTTGTCAAGAATAATAGACGGGGTATGGCTAGTGGTTACATTGTATGGGGGCAGTCGTTTGGGATTGCTTT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... PMAIP1(58801), Pmaip1(58801)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Wei Qian et al.
Oncotarget, 5(12), 4180-4194 (2014-06-24)
Overcoming platinum drug resistance represents a major clinical challenge in cancer treatment. We discovered a novel drug combination using cisplatin and a class of thioquinazolinone derivatives including mdivi-1 (mitochondrial division inhibitor-1), that induces synergistic apoptosis in platinum resistant tumor cells
Georg Karpel-Massler et al.
Oncotarget, 6(34), 36456-36471 (2015-10-17)
Glioblastoma is the most frequent primary brain tumor in adults. Current therapeutic options are sparse and the prognosis of patients suffering from this disease is grim. Abundance in intratumoral heterogeneity among different deregulated signaling pathways is a hallmark of glioblastoma
Xiao-Lan Li et al.
Oncotarget, 6(34), 36689-36699 (2015-10-10)
PRIMA-1met (APR-246) is a methylated derivative and structural analog of PRIMA-1 (p53 re-activation and induction of massive apoptosis). PRIMA-1met has been reported to restore both the wild type (wt) structure and function of mutant p53. Here, we show that PRIMA-1met