콘텐츠로 건너뛰기
Merck

EMU034351

MISSION® esiRNA

targeting mouse Cd34

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택


제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGTAGCTCTCTGCCTGATGAGTCTGCTGCATCTAAATAACTTGACTTCTGCTACCACGGAGACTTCTACACAAGGAATATCCCCATCAGTTCCTACCAATGAGTCTGTTGAGGAAAATATCACATCTAGCATCCCTGGAAGTACCAGCCACTACTTGATCTATCAGGACAGCAGTAAGACCACACCAGCCATCTCAGAGACTATGGTCAACTTTACAGTTACCTCTGGGATCCCTTCAGGCTCTGGAACTCCACACACTTTTTCACAACCACAGACTTCCCCAACTGGCATACTGCCTACTACTTCAGACAGTATTTCCACTTCAGAGATGACCTGGAAGTCCAGCCTGCCATCTATAAATGTTTCTGATTATTCGCCTAATAATAGCAGCTTTGAGATGACATCACCCACCGAGCCATATGCTTACACATCATCTTCTGCTCCGAGTGCCATTAAGGGAGAAATCAAATGCTCTGGAATCCG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Tunay Kökten et al.
PloS one, 9(1), e86011-e86011 (2014-01-28)
The sensory innervation of the dental mesenchyme is essential for tooth function and protection. Sensory innervation of the dental pulp is mediated by axons originating from the trigeminal ganglia and is strictly regulated in time. Teeth can develop from cultured
Jun-Feng Liu et al.
Experimental and therapeutic medicine, 8(3), 805-812 (2014-08-15)
The number and function of endothelial progenitor cells (EPCs) may be a predictive factor for the severity and outcome of cardiovascular disease. However, the manipulation of bone marrow mononuclear cell (BMMC) cultures for EPCs is an elaborate and difficult procedure
Luisa Boldrin et al.
PLoS currents, 3, RRN1294-RRN1294 (2012-02-16)
Satellite cells, normally quiescent underneath the myofibre basal lamina, are skeletal muscle stem cells responsible for postnatal muscle growth, repair and regeneration. Since their scarcity and small size have limited study on transverse muscle sections, techniques to isolate individual myofibres
Rifat Jan et al.
Breast cancer research : BCR, 14(6), R146-R146 (2012-11-16)
Despite the benefits of endocrine therapies such as tamoxifen and aromatase inhibitors in treating estrogen receptor (ER) alpha-positive breast cancer, many tumors eventually become resistant. The molecular mechanisms governing resistance remain largely unknown. Pigment epithelium-derived factor (PEDF) is a multifunctional
Princess I Imoukhuede et al.
PloS one, 7(9), e44791-e44791 (2012-09-18)
VEGFR surface localization plays a critical role in converting extracellular VEGF signaling towards angiogenic outcomes, and the quantitative characterization of these parameters is critical for advancing computational models; however the levels of these receptors on blood vessels is currently unknown.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.