description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCTCCTCTTCCCAGTAACCGTGGTGACTGCCTCCCAGGAGCTGGGTCCCCAGGGCCTGCACTGCCTGCATAGGGGGTGAGGAGGGCCGCAGCCACACTGCCTGGAGGATATCTGAGCCTGCCATGCCACCTGACACAGGCTGCTGGCCTTCCCAGAAGTCTACGCATTCATTGACACTGCTGCTCCTCCATCATCAGGAAGGGATGGCTCTGAGGTGTCTCAGCCTGACAAGCGAGCCTCGAGGAGCTGGAGTACGGCCCAATCTGGGCAGTATTGTGGACCACCATCCCTGCTGTTTAGAATAGGAAATTTAATGCTTGGGACAGGAGTGGGGAAGCTCGTGGTGCCCGCACCCCCCCAGTCAGAGCCTGCAGGCCTTCAAGGATCTGTGCTGAGCTCTGAGGCCCTAGATCAACACA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
mouse ... HNF1A(21405), Hnf1a(21405)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
저장 등급
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Weigong Zhao et al.
International journal of molecular sciences, 16(5), 11699-11712 (2015-05-27)
MicroRNAs (miRNAs) have been reported to have diverse biological roles in regulating many biological processes, including osteogenic differentiation. In the present study, we identified that miR-24 was a critical regulator during osteogenic differentiation. We found that overexpression of miR-24 significantly
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.