콘텐츠로 건너뛰기
Merck

EMU068571

MISSION® esiRNA

targeting mouse Tpx2

조직 및 계약 가격을 보려면 로그인를 클릭합니다.

크기 선택

보기 변경

제품정보 (DICE 배송 시 비용 별도)

NACRES:
NA.51
UNSPSC Code:
41105324
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGCGAATCAAGCAACATCCCAAGAACCAGGAAGAGTATAAGGAAGTGAACTTCATGTCTGAACTTCGGAAGCATTCTTCCACGCCTGCCCGAGGAACCAGAGGATGCACTATCATTAAGCCTTTCAACCTGTCCAAAGGGAAGAAAAGAACATTTGATGAAGCAGCTTCTACGTATGTGCCCATTGCACAGCAGGTTGAAGCCTTCCACAAACGAACCCCCAATAGATACCATCTGAGGAACAAGAAGGACGAGAGCTTGTTACCCTCCAAATCTGTGAACAAGATTGCACGAGACCCCCAGACCCCCATACTGCAGACCAAATATCGTACAAGGGCTGTGACTTGCAAAAGTACTGCAGAGCAGGAGGCCGAGGAGCTTGAGAAACTGCAACAATACAAATTCAAAGCACGGGAACTTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


저장 등급

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문



Qingquan Liu et al.
Hepatology research : the official journal of the Japan Society of Hepatology, 45(8), 906-918 (2014-09-30)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2) is a microtubule-associated protein that impacts spindle assembly in human cells. Several studies have shown that the overexpression of TPX2 is correlated with multiple tumor types. However, the role of TPX2 in
Tomohiro Miwa et al.
Cancer medicine, 4(7), 1091-1100 (2015-04-29)
The targeting protein for Xklp2 (TPX2) is a microtubule- and, cell cycle-associated protein who's overexpression has been reported in various malignancies. In this study, we verified the overexpression of TPX2 in both surgically resected specimens of pancreatic cancer and multiple
Yong Yang et al.
Asian Pacific journal of tropical medicine, 8(12), 1064-1070 (2015-12-27)
To investigate the expression of targeting protein for Xenopus kinesin-like protein 2 (TPX2) in breast cancer tissue and to explore its role in proliferation, migration and invasion of breast cancer cells. The mRNA and protein expressions of TPX2 in breast