description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCACGGAATTTGAACAGTATCTGCACTTCGTGTGCAAGCCTGAGATGGGCCTCCCCTACCAGGGGCATGACTCCGGTGTGAATCTCCCCGACAGCCACGGGGCCATTTCCTCGGTGGTGTCCGACGCCAGCTCCGCGGTATATTACTGCAACTATCCTGACGTGTGACAGGTCCCTGATCCGCCCCAGCCTGCAGGCCAGAAGCAGTGTTACACACTTCCTGGAGGAGCTAAGGAAATCCTCAGACTCCTGGGTTTTTGTTGTTGCTGTTGTTGTTTTTTAAAAGGTGTGTTGGCATATAATTTATGGTAATTTATTTTGTCTGCCACTTGAACAGTTTGGGGGGGTGAGGTTTCATTTAAAATTTGTTCAGAGATTTGTTTCCCATAGTTGGATTGTCAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SOX17(64321)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
存储类别
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Eun Hee Ha et al.
The Journal of allergy and clinical immunology, 144(2), 561-573 (2019-04-01)
IL-33, levels of which are known to be increased in patients with eosinophilic asthma and which is suggested as a therapeutic target for it, activates endothelial cells in which Sry-related high-mobility-group box (Sox) 17, an endothelium-specific transcription factor, was upregulated.
Ting Zhao et al.
Cell stem cell, 23(1), 31-45 (2018-06-26)
Chemical reprogramming provides a powerful platform for exploring the molecular dynamics that lead to pluripotency. Although previous studies have uncovered an intermediate extraembryonic endoderm (XEN)-like state during this process, the molecular underpinnings of pluripotency acquisition remain largely undefined. Here, we