Saltar al contenido
Merck

EHU025951

MISSION® esiRNA

targeting human AR

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Todas las fotos(1)

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Nombre del producto

MISSION® esiRNA, targeting human AR

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGAAGCTGCAAGGTCTTCTTCAAAAGAGCCGCTGAAGGGAAACAGAAGTACCTGTGCGCCAGCAGAAATGATTGCACTATTGATAAATTCCGAAGGAAAAATTGTCCATCTTGTCGTCTTCGGAAATGTTATGAAGCAGGGATGACTCTGGGAGCCCGGAAGCTGAAGAAACTTGGTAATCTGAAACTACAGGAGGAAGGAGAGGCTTCCAGCACCACCAGCCCCACTGAGGAGACAACCCAGAAGCTGACAGTGTCACACATTGAAGGCTATGAATGTCAGCCCATCTTTCTGAATGTCCTGGAAGCCATTGAGCCAGGTGTAGTGTGTGCTGGACACGACAACAACCAGCCCGACTCCTTTGCAGCCTTGCTCTCTAGCCTCAATGAACTGGGAGAGAGACAGCTTGTACACGTGGTCAAGTGGGCCAAGGCCTTGCCTGGCTTCCGCAACTTACACGTGGACGACCAGATGGCTGTCATTCA

Ensembl | human accession no.

ENSG00000169083

NCBI accession no.

NM_000044

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... AR(367), AR(367)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
NAV
TZU
XQU
CNU
EJU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chenfei Wang et al.
Nature cell biology, 20(5), 620-631 (2018-04-25)
H3K9me3-dependent heterochromatin is a major barrier of cell fate changes that must be reprogrammed after fertilization. However, the molecular details of these events are lacking in early embryos. Here, we map the genome-wide distribution of H3K9me3 modifications in mouse early
Sekar Natesampillai et al.
Journal of immunology (Baltimore, Md. : 1950), 203(3), 718-724 (2019-06-14)
CD4 T cells from HIV-1 infected patients die at excessive rates compared to those from uninfected patients, causing immunodeficiency. We previously identified a dominant negative ligand that antagonizes the TRAIL-dependent pathway of cell death, which we called TRAILshort. Because the
Nathan R Zemke et al.
Cell host & microbe, 22(6), 789-800 (2017-12-15)
The N-terminal half of adenovirus e1a assembles multimeric complexes with host proteins that repress innate immune responses and force host cells into S-phase. In contrast, the functions of e1a's C-terminal interactions with FOXK, DCAF7, and CtBP are unknown. We found
Madison Schank et al.
Cell death & disease, 11(12), 1030-1030 (2020-12-04)
Telomere erosion and mitochondrial dysfunction are prominent features of aging cells with progressive declines of cellular functions. Whether telomere injury induces mitochondrial dysfunction in human T lymphocytes, the major component of adaptive host immunity against infection and malignancy, remains unclear.
Zuzana Krchnáková et al.
Nucleic acids research, 47(2), 911-928 (2018-11-18)
Many nascent long non-coding RNAs (lncRNAs) undergo the same maturation steps as pre-mRNAs of protein-coding genes (PCGs), but they are often poorly spliced. To identify the underlying mechanisms for this phenomenon, we searched for putative splicing inhibitory sequences using the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico