Saltar al contenido
Merck

EHU002381

MISSION® esiRNA

targeting human EGLN2, RAB4B-EGLN2

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGGCAGCTATGTCATCAACGGGCGCACCAAGGCCATGGTGGCGTGTTACCCAGGCAACGGGCTCGGGTACGTAAGGCACGTTGACAATCCCCACGGCGATGGGCGCTGCATCACCTGTATCTATTACCTGAATCAGAACTGGGACGTTAAGGTGCATGGCGGCCTGCTGCAGATCTTCCCTGAGGGCCGGCCCGTGGTAGCCAACATCGAGCCACTCTTTGACCGGTTGCTCATTTTCTGGTCTGACCGGCGGAACCCCCACGAGGTGAAGCCAGCCTATGCCACCAGGTACGCCATCACTGTCTGGTATTTTGATGCCAAGGAGCGGGCAGCAGCCAAAGACAAGTATCAGCTAGCATCAGGACAGAAAGGTGTCCAAGTACCTGTATCACAGCCGCCTACGCCCACCTAGTGGCCAGTCCCAGAGCCGCATGGCAGACAGCTTAAATGACTTCAGGAGAGCCCTGGGCCTGTGCTGGCTGCTCCTTCCCTGCCACCGCTGCTGCTTCTGACTTTGCCTCTGTCCTGCCTGGTGTGGAGGGCTCTGTCTGTTGCTGAGGACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alessandro Rolfo et al.
PloS one, 5(10), e13288-e13288 (2010-10-23)
The pathogenesis of preeclampsia, a serious pregnancy disorder, is still elusive and its treatment empirical. Hypoxia Inducible Factor-1 (HIF-1) is crucial for placental development and early detection of aberrant regulatory mechanisms of HIF-1 could impact on the diagnosis and management
Ling Li et al.
The Journal of clinical investigation, 129(6), 2374-2389 (2019-03-27)
Acute kidney injury (AKI) can lead to chronic kidney disease (CKD) if injury is severe and/or repair is incomplete. However, the pathogenesis of CKD following renal ischemic injury is not fully understood. Capillary rarefaction and tubular hypoxia are common findings
R V Durán et al.
Oncogene, 32(38), 4549-4556 (2012-10-23)
Hypoxia-inducible factor (HIF) prolyl hydroxylases (PHDs) are α-ketoglutarate (αKG)-dependent dioxygenases that function as cellular oxygen sensors. However, PHD activity also depends on factors other than oxygen, especially αKG, a key metabolic compound closely linked to amino-acid metabolism. We examined the

Contenido relacionado

Instructions

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico