Saltar al contenido
Merck

EHU007051

MISSION® esiRNA

targeting human S100B

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGACCAGGAAGGGGTGAGACAAGGAAGAGGATGTCTGAGCTGGAGAAGGCCATGGTGGCCCTCATCGACGTTTTCCACCAATATTCTGGAAGGGAGGGAGACAAGCACAAGCTGAAGAAATCCGAACTGAAGGAGCTCATCAACAATGAGCTTTCCCATTTCTTAGAGGAAATCAAAGAGCAGGAGGTTGTGGACAAAGTCATGGAAACACTGGACAATGATGGAGACGGCGAATGTGACTTCCAGGAATTCATGGCCTTTGTTGCCATGGTTACTACTGCCTGCCACGAGTTCTTTGAACATGAGTGAGATTAGAAAGCAGCCAAACCTTTCCTGTAACAGAGACGGTCATGCAAGAAAGCAGACAGCAAGGGCTTGCAGCCTAGTAGGAGCTGAGCTTTCCAGCCGTGTTGTAGCTAATTAGGAAGCTTGATTTGCTTTGTGATTGAAAAATTGAAAACCTCTTTCCAAAGGCTGTTTTAACGGCCTGCATCATTCTTTCTGCTATATTAGGCCTGTGTGTAAGCTGACTGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... S100B(6285)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos


Contenido relacionado

Instructions


Teng Cao et al.
Biochimica et biophysica acta, 1863(11), 2772-2782 (2017-07-12)
S100B is a biomarker of nervous system injury, but it is unknown if it is also involved in vascular injury. In the present study, we investigated S100B function in vascular remodeling following injury. Balloon injury in rat carotid artery progressively
Giulio Morozzi et al.
Cell death and differentiation, 24(12), 2077-2088 (2017-09-09)
Muscles of sarcopenic people show hypotrophic myofibers and infiltration with adipose and, at later stages, fibrotic tissue. The origin of infiltrating adipocytes resides in fibro-adipogenic precursors and nonmyogenic mesenchymal progenitor cells, and in satellite cells, the adult stem cells of
Jin-Hua Zhang et al.
Journal of cellular biochemistry, 119(10), 8095-8111 (2018-02-01)
Ischemic stroke is the leading cause of worldwide mortality and long-term disability in adults. This study aims to explore the effects of RNA interference (RNAi)-mediated silencing of the S100B gene on nerve function recovery and morphological changes of hippocampus cells