Saltar al contenido
Merck

EHU008631

MISSION® esiRNA

targeting human USP37

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGGTTCAGCACTCCATCATTTGTAAAGCATGTGGAGAGATTATCCCCAAAAGAGAACAGTTTAATGACCTCTCTATTGACCTTCCTCGTAGGAAAAAACCACTCCCTCCTCGTTCAATTCAAGATTCTCTTGATCTTTTCTTTAGGGCCGAAGAACTGGAGTATTCTTGTGAGAAGTGTGGTGGGAAGTGTGCTCTTGTCAGGCACAAATTTAACAGGCTTCCTAGGGTCCTCATTCTCCATTTGAAACGATATAGCTTCAATGTGGCTCTCTCGCTTAACAATAAGATTGGGCAGCAAGTCATCATTCCAAGATACCTGACCCTGTCATCTCATTGCACTGAAAATACAAAACCACCTTTTACCCTTGGTTGGAGTGCACATATGGCAATTTCTAGACCATTGAAAGCCTCTCAAATGGTGAATTCCTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Debjani Pal et al.
Cell death & disease, 11(4), 298-298 (2020-04-30)
APC/CCdh1 is a ubiquitin ligase with roles in numerous diverse processes, including control of cellular proliferation and multiple aspects of the DNA damage response. Precise regulation of APC/CCdh1 activity is central to efficient cell-cycle progression and cellular homeostasis. Here, we
Seok Kim et al.
Cancers, 11(3) (2019-03-14)
WP1130, a partially selective deubiquitinases (DUB) inhibitor, inhibits the deubiquitinating activities of USP5, USP9X, USP14, USP37, and UCHL1. In this study, we investigate whether WP1130 exerts sensitizing effect on TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in human renal carcinoma cells. Combinations
Zhenna Xiao et al.
American journal of cancer research, 9(12), 2749-2759 (2020-01-09)
SNAI1, an epithelial-mesenchymal transition (EMT)-inducing transcription factor, promotes tumor metastasis and resistance to apoptosis and chemotherapy. SNAI1 protein levels are tightly regulated by proteolytic ubiquitination. Here, we identified USP37 as a SNAI1 deubiquitinase that removes the polyubiquitination chain from SNAI1

Contenido relacionado

Instructions

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico