Saltar al contenido
Merck

EHU015211

MISSION® esiRNA

targeting human IVL

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGTCCCAGCAACACACACTGCCAGTGACCCTCTCCCCTGCCCTCAGTCAGGAGCTCCTCAAGACTGTTCCTCCTCCAGTCAATACCCATCAGGAGCAAATGAAACAGCCAACTCCACTGCCTCCCCCATGCCAGAAGGTGCCTGTCGAGCTCCCAGTGGAGGTCCCATCAAAGCAAGAGGAAAAGCACATGACTGCTGTAAAGGGACTGCCTGAGCAAGAATGTGAGCAACAGCAGAAGGAGCCACAGGAGCAGGAGCTGCAGCAACAGCACTGGGAACAGCATGAGGAATATCAGAAAGCAGAAAACCCAGAGCAGCAGCTTAAGCAGGAGAAAACACAAAGGGATCAGCAGCTAAACAAACAGCTGGAAGAAGAGAAGAAGCTCTTAGACCAGCAACTGGATCAAGAGCTAGTCAAGAGAGATGAGCAACTGGGAATGAAGAAAGAGCAACTGTTGGAGCTCCCAGAGCAGCAGGAGGGGCACCTGAAGCACCTAGAGCAGCAGGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Feng-Ning F Yuan et al.
International journal of oncology, 44(5), 1625-1633 (2014-03-15)
The secosteroidal hormone 1,25-dihyroxyvitamin D [1,25(OH)(2)D(3)] and its receptor, the vitamin D receptor (VDR), are crucial regulators of epidermal proliferation and differentiation. However, the effects of 1,25(OH)(2)D(3)-directed signaling on oral keratinocyte pathophysiology have not been well studied. We examined the
Roberta Lotti et al.
International journal of molecular sciences, 17(1) (2016-01-16)
Squamous Cell Carcinoma-derived Stem-like Cells (SCC-SC) originate from alterations in keratinocyte stem cells (KSC) gene expression and sustain tumor development, invasion and recurrence. Since survivin, a KSC marker, is highly expressed in SCC-SC, we evaluate its role in SCC-SC cell
Katiuscia Dallaglio et al.
International journal of molecular sciences, 14(10), 19540-19555 (2013-10-01)
In human epidermis, keratinocyte stem cells (KSC) are characterized by high levels of β1-integrin, resulting in the rapid adhesion to type IV collagen. Since epithelial tumors originate from KSC, we evaluated the features of rapidly adhering (RAD) keratinocytes derived from
Susanne Grether-Beck et al.
The Journal of investigative dermatology, 132(6), 1561-1572 (2012-03-16)
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though

Contenido relacionado

Instructions

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico