Saltar al contenido
Merck

EHU022031

MISSION® esiRNA

targeting human STAT6

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human STAT6

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCCAAAGCCACTATCCTGTGGGACAATGCCTTCTCTGAGATGGACCGCGTGCCCTTTGTGGTGGCTGAGCGGGTGCCCTGGGAGAAGATGTGTGAAACTCTGAACCTGAAGTTCATGGCTGAGGTGGGGACCAACCGGGGGCTGCTCCCAGAGCACTTCCTCTTCCTGGCCCAGAAGATCTTCAATGACAACAGCCTCAGTATGGAGGCCTTCCAGCACCGTTCTGTGTCCTGGTCGCAGTTCAACAAGGAGATCCTGCTGGGCCGTGGCTTCACCTTTTGGCAGTGGTTTGATGGTGTCCTGGACCTCACCAAACGCTGTCTCCGGAGCTACTGGTCTGACCGGCTGATCATTGGCTTCATCAGCAAACAGTACGTTACTAGCCTTCTTCTCAATGAGCCCGACGGAACCTTTCTCCTCCGCTTCAGCGACTCAGAGATTGGGGGCATCACCATTGCCCATGTCATCCGGGGCCAGGATGGCTCTCCACAGAT

Ensembl | human accession no.

ENSG00000166888

NCBI accession no.

NM_003153

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... STAT6(6778), STAT6(6778)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
WET

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tian Qing et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 1-6 (2017-05-20)
Signal transducer and activator of transcription-6 (STAT6) is highly expressed in various human cancers and considered a regulator of multiple biological processes in cancers, including cell apoptosis. Evidence has indicated that STAT6 predicts a worse prognosis in hepatocellular carcinoma (HCC)
Zachary P McKay et al.
Journal of immunology (Baltimore, Md. : 1950), 206(6), 1385-1394 (2021-01-29)
Crosstalk between costimulatory and coinhibitory ligands are a prominent node of immune cell regulation. Mounting evidence points toward a critical role for CD155, the poliovirus receptor, in suppressing T cell function, particularly in cancer. However, relative to other known costimulatory/coinhibitory
Li Yang et al.
Cellular & molecular immunology, 13(5), 669-677 (2015-07-21)
The etiology and the underlying mechanism of CD4(+) T-cell polarization are unclear. This study sought to investigate the mechanism by which interleukin (IL)-13 prevents the activation-induced apoptosis of CD4(+) T cells. Here we report that CD4(+) T cells expressed IL-13
Noelia Keiran et al.
Nature immunology, 20(5), 581-592 (2019-04-10)
Succinate is a signaling metabolite sensed extracellularly by succinate receptor 1 (SUNCR1). The accumulation of succinate in macrophages is known to activate a pro-inflammatory program; however, the contribution of SUCNR1 to macrophage phenotype and function has remained unclear. Here we
Han Liu et al.
Oncotarget, 8(24), 38113-38135 (2017-05-13)
Human colon cancers express higher levels of NADPH oxidase 1 [NOX1] than adjacent normal epithelium. It has been suggested that reactive oxygen species [ROS] derived from NOX1 contribute to DNA damage and neoplastic transformation in the colon, particularly during chronic
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico