Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGACGCAGTCCTGAGGTTTAATGGGGCACCCACAGCCAACTTCCAACAAGATGTGGGCACAAAAACTACCATTCGCCTGATGAACTCTCAGTTGGTTACCACAGAGAAGCGCTTCCTCAAAGACAGTTTGTACAATGAAGGAATCCTAATTGTATGGGACCCATCTGTATACCACTCAGATATCCCAAAGTGGTACCAGAATCCGGATTATAATTTCTTTAACAACTACAAGACTTATCGTAAGCTGCACCCCAATCAGCCCTTTTACATCCTCAAGCCCCAGATGCCTTGGGAGCTATGGGACATTCTTCAAGAAATCTCCCCAGAAGAGATTCAGCCAAACCCCCCATCCTCTGGGATGCTTGGTATCATCATCATGATGACGCTGTGTGACCAGGTGGATA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ST6GAL1(6480)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Jun Zhang et al.
Biochemical and biophysical research communications, 500(2), 249-255 (2018-04-15)
Monocyte transendothelial migration is a critical step in the initial stage of atherosclerosis, in which the involvement of α-2,6 sialyltransferase 1 (ST6GAL1) has been confirmed by increasing evidence. But the direct relationship between ST6GAL1 and atherosclerosis remains incompletely uncertain. In
Yu-Chieh Wang et al.
Scientific reports, 5, 13317-13317 (2015-08-26)
Many studies have suggested the significance of glycosyltransferase-mediated macromolecule glycosylation in the regulation of pluripotent states in human pluripotent stem cells (hPSCs). Here, we observed that the sialyltransferase ST6GAL1 was preferentially expressed in undifferentiated hPSCs compared to non-pluripotent cells. A