Saltar al contenido
Merck

EHU058861

MISSION® esiRNA

targeting human RIPK3

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGACTGACCCCTGCACAGACAGACCCCTTCCCCTCTCTGCGAAAGGACCAAGCCCCAGAAGTCACTCCATCTCCTACGGCTCGCAATTTCCAGAGGCCCCCTGGCACCTTCCAGCCTGATGTCGTGCGTCAAGTTATGGCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAACTGGAGAACCAGGAGCTCGTCGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACATAGGAAGTGGGGCTACGATGTGGCGGTCAAGATCGTAAACTCGAAGGCGATATCCAGGGAGGTCAAGGCCATGGCAAGTCTGGATAACGAATTCGTGCTGCGCCTAGAAGGGGTTATCGAGAAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGACTAAATTCATGGAGAACGGCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Diego Martin-Sanchez et al.
Scientific reports, 7, 41510-41510 (2017-02-01)
Iron deficiency has been associated with kidney injury. Deferasirox is an oral iron chelator used to treat blood transfusion-related iron overload. Nephrotoxicity is the most serious and common adverse effect of deferasirox and may present as an acute or chronic
Alessandra Pescatore et al.
Cell death & disease, 7(8), e2346-e2346 (2016-08-26)
Incontinentia Pigmenti (IP) is a rare X-linked disease characterized by early male lethality and multiple abnormalities in heterozygous females. IP is caused by NF-κB essential modulator (NEMO) mutations. The current mechanistic model suggests that NEMO functions as a crucial component
Yu Matsuzawa-Ishimoto et al.
The Journal of experimental medicine, 214(12), 3687-3705 (2017-11-02)
A variant of the autophagy gene
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Xinghui Li et al.
Immunity, 50(3), 576-590 (2019-02-17)
Elevated glucose metabolism in immune cells represents a hallmark feature of many inflammatory diseases, such as sepsis. However, the role of individual glucose metabolic pathways during immune cell activation and inflammation remains incompletely understood. Here, we demonstrate a previously unrecognized

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico