Saltar al contenido
Merck

EHU060601

MISSION® esiRNA

targeting human DNMT1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCCACAGATGCTGACAAATGAGAAGCTGTCCATCTTTGATGCCAACGAGTCTGGCTTTGAGAGTTATGAGGCGCTTCCCCAGCACAAACTGACCTGCTTCAGTGTGTACTGTAAGCACGGTCACCTGTGTCCCATCGACACCGGCCTCATCGAGAAGAATATCGAACTCTTCTTTTCTGGTTCAGCAAAACCAATCTATGATGATGACCCATCTCTTGAAGGTGGTGTTAATGGCAAAAATCTTGGCCCCATAAATGAATGGTGGATCACTGGCTTTGATGGAGGTGAAAAGGCCCTCATCGGCTTCAGCACCTCATTTGCCGAATACATTCTGATGGATCCCAGTCCCGAGTATGCGCCCATATTTGGGCTGATGCAGGAGAAGATCTACATCAGCAAGATTGTGGTGGAGTTCCTGCAGAGCAATTCCGACTCGACCTATGAGGACCTGATCAACAAGATCGAGACCACGGTTCCTCCTTCT

Ensembl | human accession no.

ENSG00000130816

NCBI accession no.

NM_001379

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... DNMT1(1786)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
OAV
NZU
CSU
CRU
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shuhao Fu et al.
Experimental eye research, 165, 47-58 (2017-09-13)
The principle reason of high failure rate of glaucoma filtration surgery is the loss of filtration function caused by postoperative scar formation. We investigated the effects of 5-aza-2'-deoxycytidine (5-Aza-dc), a DNA methyltransferases inhibitor, on human Tenon's capsule fibroblasts (HTFs) differentiation
Arunagiri Kuha Deva Magendhra Rao et al.
Molecular oncology, 13(6), 1342-1355 (2019-04-09)
Breast cancer is the most common malignancy among women, with the highest incidence rate worldwide. Dysregulation of long noncoding RNAs during the preliminary stages of breast carcinogenesis is poorly understood. In this study, we performed RNA sequencing to identify long
Fangcao Jin et al.
Stem cell research & therapy, 11(1), 444-444 (2020-10-21)
Dysfunction of the DNA methylation was associated with stem cell reprogramming. Moreover, DNA methyltransferase 1 (DNMT1) deficiency was involved in the differentiation of hair follicle stem cell (HFSc), but the molecular mechanisms remain unknown. HFSc from human scalp tissues were
Ercan Cacan
Journal of chemotherapy (Florence, Italy), 29(3), 173-178 (2017-01-20)
Regulator of G-protein signaling 2 (RGS2) is a GTPase-activating protein functioning as an inhibitor of G-protein coupled receptors (GPCRs). RGS2 dysregulation was implicated in solid tumour development and RGS2 downregulation has been reported in prostate and ovarian cancer progression. However
Wen-Long Xue et al.
American journal of physiology. Cell physiology, 318(5), C857-C869 (2020-03-19)
Diabetes (especially Type II) is one of the primary threats to cardiovascular health. Wound healing defects and vascular dysfunction are common in diabetic patients, and the primary cause of deterioration is sustained high plasma glucose. microRNA, a noncoding RNA, has
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico