Saltar al contenido
Merck

EHU061031

MISSION® esiRNA

targeting human SRPK1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTGTTGAAAGACCCTTGAAAGAGAACCCACCTAATAAAATGACCCAAGAAAAACTTGAAGAGTCAAGTACCATTGGCCAGGATCAAACGCTTATGGAACGTGATACAGAGGGTGGTGCAGCAGAAATTAATTGCAATGGAGTGATTGAAGTCATTAATTATACTCAGAACAGTAATAATGAAACATTGAGACATAAAGAGGATCTACATAATGCTAATGACTGTGATGTCCAAAATTTGAATCAGGAATCTAGTTTCCTAAGCTCCCAAAATGGAGACAGCAGCACATCTCAAGAAACAGACTCTTGTACACCTATAACATCTGAGGTGTCAGACACCATGGTGTGCCAGTCTTCCTCAACTGTAGGTCAGTCATTCAGTGAACAACACATTAGCCAACTTCAAGAAAGCATTCGGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SRPK1(6732)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhengbu Liao et al.
Molecular neurobiology, 54(3), 1818-1824 (2016-02-19)
Up to now, the serine-arginine protein kinase 1 (SRPK1) has been suggested as an important signal mediator, which is implicated in the development of cancers. Unfortunately, some molecular pathways in SRPK1-mediated epithelial-mesenchymal transition (EMT) in human spinal glioblastoma have been
Parmanand Malvi et al.
Oncogenesis, 9(8), 77-77 (2020-08-30)
Triple-negative breast cancer (TNBC) is a highly metastatic breast cancer subtype and due to the lack of hormone receptors and HER2 expression, TNBC has limited therapeutic options with chemotherapy being the primary choice for systemic therapy. LIM Domain Kinase 2
M V Gammons et al.
British journal of cancer, 111(3), 477-485 (2014-07-11)
Current therapies for metastatic melanoma are targeted either at cancer mutations driving growth (e.g., vemurafenib) or immune-based therapies (e.g., ipilimumab). Tumour progression also requires angiogenesis, which is regulated by VEGF-A, itself alternatively spliced to form two families of isoforms, pro-

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico