Saltar al contenido
Merck

EHU069171

MISSION® esiRNA

targeting human PRKCB

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCAAATGCTCCCTCAACCCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTGTCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCCTTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAGGAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAACTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAGACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACCGATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAACGAAAAGGCACAGATGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRKCB(5579)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Martina Haller et al.
The Journal of biological chemistry, 291(45), 23557-23568 (2016-09-15)
Dysfunctional mitochondria contribute to the development of many diseases and pathological conditions through the excessive production of reactive oxygen species (ROS), and, where studied, ablation of p66Shc (p66) was beneficial. p66 translocates to the mitochondria and oxidizes cytochrome c to
Jessica Bullenkamp et al.
Apoptosis : an international journal on programmed cell death, 20(6), 831-842 (2015-04-02)
Apoptin, the VP3 protein from chicken anaemia virus (CAV), induces tumour cell-specific cell death and represents a potential future anti-cancer therapeutic. In tumour but not in normal cells, Apoptin is phosphorylated and translocates to the nucleus, enabling its cytotoxic activity.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico